Merge "Snap for 4416925 from f5e4cdca6dbad04ebff46e6d4b8e0c96969c199d to oreo-cts-release" into oreo-cts-release
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index 419b2af..c9a6898 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -2522,28 +2522,21 @@
if (CanGenerateTest(condition, codegen_->GetAssembler())) {
Label* non_fallthrough_target;
bool invert;
- bool emit_both_branches;
if (true_target_in == nullptr) {
- // The true target is fallthrough.
DCHECK(false_target_in != nullptr);
non_fallthrough_target = false_target_in;
invert = true;
- emit_both_branches = false;
} else {
- // Either the false target is fallthrough, or there is no fallthrough
- // and both branches must be emitted.
non_fallthrough_target = true_target_in;
invert = false;
- emit_both_branches = (false_target_in != nullptr);
}
const auto cond = GenerateTest(condition, invert, codegen_);
__ b(non_fallthrough_target, cond.first);
- if (emit_both_branches) {
- // No target falls through, we need to branch.
+ if (false_target_in != nullptr && false_target_in != non_fallthrough_target) {
__ b(false_target_in);
}
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index da146d7..fccb567 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -3563,6 +3563,9 @@
size_t condition_input_index,
vixl::aarch64::Label* true_target,
vixl::aarch64::Label* false_target) {
+ // FP branching requires both targets to be explicit. If either of the targets
+ // is nullptr (fallthrough) use and bind `fallthrough_target` instead.
+ vixl::aarch64::Label fallthrough_target;
HInstruction* cond = instruction->InputAt(condition_input_index);
if (true_target == nullptr && false_target == nullptr) {
@@ -3663,6 +3666,10 @@
if (true_target != nullptr && false_target != nullptr) {
__ B(false_target);
}
+
+ if (fallthrough_target.IsLinked()) {
+ __ Bind(&fallthrough_target);
+ }
}
void LocationsBuilderARM64::VisitIf(HIf* if_instr) {
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index c37cc52..59cd5f9 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -2557,28 +2557,21 @@
if (CanGenerateTest(condition, codegen_->GetAssembler())) {
vixl32::Label* non_fallthrough_target;
bool invert;
- bool emit_both_branches;
if (true_target_in == nullptr) {
- // The true target is fallthrough.
DCHECK(false_target_in != nullptr);
non_fallthrough_target = false_target_in;
invert = true;
- emit_both_branches = false;
} else {
non_fallthrough_target = true_target_in;
invert = false;
- // Either the false target is fallthrough, or there is no fallthrough
- // and both branches must be emitted.
- emit_both_branches = (false_target_in != nullptr);
}
const auto cond = GenerateTest(condition, invert, codegen_);
__ B(cond.first, non_fallthrough_target);
- if (emit_both_branches) {
- // No target falls through, we need to branch.
+ if (false_target_in != nullptr && false_target_in != non_fallthrough_target) {
__ B(false_target_in);
}
diff --git a/runtime/arch/arm64/quick_entrypoints_arm64.S b/runtime/arch/arm64/quick_entrypoints_arm64.S
index 820ba0e..7220644 100644
--- a/runtime/arch/arm64/quick_entrypoints_arm64.S
+++ b/runtime/arch/arm64/quick_entrypoints_arm64.S
@@ -2611,19 +2611,19 @@
RESTORE_TWO_REGS x14, x15, 112
RESTORE_TWO_REGS x18, x19, 128 // Skip x16, x17, i.e. IP0, IP1.
RESTORE_REG xLR, 144 // Restore return address.
- // Restore caller-save floating-point registers.
- ldp d0, d1, [sp, #160]
- ldp d2, d3, [sp, #176]
- ldp d4, d5, [sp, #192]
- ldp d6, d7, [sp, #208]
- ldp d16, d17, [sp, #224]
- ldp d18, d19, [sp, #240]
- ldp d20, d21, [sp, #256]
- ldp d22, d23, [sp, #272]
- ldp d24, d25, [sp, #288]
- ldp d26, d27, [sp, #304]
- ldp d28, d29, [sp, #320]
- ldp d30, d31, [sp, #336]
+ // Save all potentially live caller-save floating-point registers.
+ stp d0, d1, [sp, #160]
+ stp d2, d3, [sp, #176]
+ stp d4, d5, [sp, #192]
+ stp d6, d7, [sp, #208]
+ stp d16, d17, [sp, #224]
+ stp d18, d19, [sp, #240]
+ stp d20, d21, [sp, #256]
+ stp d22, d23, [sp, #272]
+ stp d24, d25, [sp, #288]
+ stp d26, d27, [sp, #304]
+ stp d28, d29, [sp, #320]
+ stp d30, d31, [sp, #336]
ldr x0, [lr, #\ldr_offset] // Load the instruction.
adr xIP1, .Lmark_introspection_return_switch
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index 67038b4..7de8916 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -403,19 +403,15 @@
bool ArtMethod::IsAnnotatedWithFastNative() {
return IsAnnotatedWith(WellKnownClasses::dalvik_annotation_optimization_FastNative,
- DexFile::kDexVisibilityBuild,
- /* lookup_in_resolved_boot_classes */ true);
+ DexFile::kDexVisibilityBuild);
}
bool ArtMethod::IsAnnotatedWithCriticalNative() {
return IsAnnotatedWith(WellKnownClasses::dalvik_annotation_optimization_CriticalNative,
- DexFile::kDexVisibilityBuild,
- /* lookup_in_resolved_boot_classes */ true);
+ DexFile::kDexVisibilityBuild);
}
-bool ArtMethod::IsAnnotatedWith(jclass klass,
- uint32_t visibility,
- bool lookup_in_resolved_boot_classes) {
+bool ArtMethod::IsAnnotatedWith(jclass klass, uint32_t visibility) {
Thread* self = Thread::Current();
ScopedObjectAccess soa(self);
StackHandleScope<1> shs(self);
@@ -424,8 +420,10 @@
DCHECK(annotation->IsAnnotation());
Handle<mirror::Class> annotation_handle(shs.NewHandle(annotation));
- return annotations::IsMethodAnnotationPresent(
- this, annotation_handle, visibility, lookup_in_resolved_boot_classes);
+ // Note: Resolves any method annotations' classes as a side-effect.
+ // -- This seems allowed by the spec since it says we can preload any classes
+ // referenced by another classes's constant pool table.
+ return annotations::IsMethodAnnotationPresent(this, annotation_handle, visibility);
}
static uint32_t GetOatMethodIndexFromMethodIndex(const DexFile& dex_file,
diff --git a/runtime/art_method.h b/runtime/art_method.h
index 9ed056a..856bfd2 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -716,10 +716,7 @@
private:
uint16_t FindObsoleteDexClassDefIndex() REQUIRES_SHARED(Locks::mutator_lock_);
- // If `lookup_in_resolved_boot_classes` is true, look up any of the
- // method's annotations' classes in the bootstrap class loader's
- // resolved types; otherwise, resolve them as a side effect.
- bool IsAnnotatedWith(jclass klass, uint32_t visibility, bool lookup_in_resolved_boot_classes);
+ bool IsAnnotatedWith(jclass klass, uint32_t visibility);
static constexpr size_t PtrSizedFieldsOffset(PointerSize pointer_size) {
// Round up to pointer size for padding field. Tested in art_method.cc.
diff --git a/runtime/dex_file_annotations.cc b/runtime/dex_file_annotations.cc
index ebacb27..005bb4a 100644
--- a/runtime/dex_file_annotations.cc
+++ b/runtime/dex_file_annotations.cc
@@ -751,8 +751,7 @@
const ClassData& klass,
const DexFile::AnnotationSetItem* annotation_set,
uint32_t visibility,
- Handle<mirror::Class> annotation_class,
- bool lookup_in_resolved_boot_classes = false)
+ Handle<mirror::Class> annotation_class)
REQUIRES_SHARED(Locks::mutator_lock_) {
const DexFile& dex_file = klass.GetDexFile();
for (uint32_t i = 0; i < annotation_set->size_; ++i) {
@@ -762,37 +761,19 @@
}
const uint8_t* annotation = annotation_item->annotation_;
uint32_t type_index = DecodeUnsignedLeb128(&annotation);
- mirror::Class* resolved_class;
- if (lookup_in_resolved_boot_classes) {
- ObjPtr<mirror::Class> looked_up_class =
- Runtime::Current()->GetClassLinker()->LookupResolvedType(
- klass.GetDexFile(),
- dex::TypeIndex(type_index),
- klass.GetDexCache(),
- // Force the use of the bootstrap class loader.
- static_cast<mirror::ClassLoader*>(nullptr));
- resolved_class = looked_up_class.Ptr();
- if (resolved_class == nullptr) {
- // If `resolved_class` is null, this is fine: just ignore that
- // annotation item. We expect this to happen, as we do not
- // attempt to resolve the annotation's class in this code path.
- continue;
- }
- } else {
- StackHandleScope<2> hs(Thread::Current());
- resolved_class = Runtime::Current()->GetClassLinker()->ResolveType(
- klass.GetDexFile(),
- dex::TypeIndex(type_index),
- hs.NewHandle(klass.GetDexCache()),
- hs.NewHandle(klass.GetClassLoader()));
- if (resolved_class == nullptr) {
- std::string temp;
- LOG(WARNING) << StringPrintf("Unable to resolve %s annotation class %d",
- klass.GetRealClass()->GetDescriptor(&temp), type_index);
- CHECK(Thread::Current()->IsExceptionPending());
- Thread::Current()->ClearException();
- continue;
- }
+ StackHandleScope<2> hs(Thread::Current());
+ mirror::Class* resolved_class = Runtime::Current()->GetClassLinker()->ResolveType(
+ klass.GetDexFile(),
+ dex::TypeIndex(type_index),
+ hs.NewHandle(klass.GetDexCache()),
+ hs.NewHandle(klass.GetClassLoader()));
+ if (resolved_class == nullptr) {
+ std::string temp;
+ LOG(WARNING) << StringPrintf("Unable to resolve %s annotation class %d",
+ klass.GetRealClass()->GetDescriptor(&temp), type_index);
+ CHECK(Thread::Current()->IsExceptionPending());
+ Thread::Current()->ClearException();
+ continue;
}
if (resolved_class == annotation_class.Get()) {
return annotation_item;
@@ -1219,20 +1200,15 @@
return GetSignatureValue(ClassData(method), annotation_set);
}
-bool IsMethodAnnotationPresent(ArtMethod* method,
- Handle<mirror::Class> annotation_class,
- uint32_t visibility /* = DexFile::kDexVisibilityRuntime */,
- bool lookup_in_resolved_boot_classes /* = false */) {
+bool IsMethodAnnotationPresent(ArtMethod* method, Handle<mirror::Class> annotation_class,
+ uint32_t visibility /* = DexFile::kDexVisibilityRuntime */) {
const DexFile::AnnotationSetItem* annotation_set = FindAnnotationSetForMethod(method);
if (annotation_set == nullptr) {
return false;
}
const DexFile::AnnotationItem* annotation_item =
GetAnnotationItemFromAnnotationSet(ClassData(method),
- annotation_set,
- visibility,
- annotation_class,
- lookup_in_resolved_boot_classes);
+ annotation_set, visibility, annotation_class);
return annotation_item != nullptr;
}
diff --git a/runtime/dex_file_annotations.h b/runtime/dex_file_annotations.h
index e108882..651c984 100644
--- a/runtime/dex_file_annotations.h
+++ b/runtime/dex_file_annotations.h
@@ -65,15 +65,8 @@
REQUIRES_SHARED(Locks::mutator_lock_);
mirror::ObjectArray<mirror::String>* GetSignatureAnnotationForMethod(ArtMethod* method)
REQUIRES_SHARED(Locks::mutator_lock_);
-// Check whether `method` is annotated with `annotation_class`.
-// If `lookup_in_resolved_boot_classes` is true, look up any of the
-// method's annotations' classes in the bootstrap class loader's
-// resolved types; if it is false (default value), resolve them as a
-// side effect.
-bool IsMethodAnnotationPresent(ArtMethod* method,
- Handle<mirror::Class> annotation_class,
- uint32_t visibility = DexFile::kDexVisibilityRuntime,
- bool lookup_in_resolved_boot_classes = false)
+bool IsMethodAnnotationPresent(ArtMethod* method, Handle<mirror::Class> annotation_class,
+ uint32_t visibility = DexFile::kDexVisibilityRuntime)
REQUIRES_SHARED(Locks::mutator_lock_);
// Class annotations.
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index 629148e..2b349e3 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -2075,39 +2075,11 @@
REQUIRES_SHARED(Locks::mutator_lock_) {
ArtMethod* called = *sp;
DCHECK(called->IsNative()) << called->PrettyMethod(true);
- // Fix up a callee-save frame at the bottom of the stack (at `*sp`,
- // above the alloca region) while we check for optimization
- // annotations, thus allowing stack walking until the completion of
- // the JNI frame creation.
- //
- // Note however that the Generic JNI trampoline does not expect
- // exception being thrown at that stage.
- *sp = Runtime::Current()->GetCalleeSaveMethod(Runtime::CalleeSaveType::kSaveRefsAndArgs);
- self->SetTopOfStack(sp);
uint32_t shorty_len = 0;
const char* shorty = called->GetShorty(&shorty_len);
- // Optimization annotations lookup does not try to resolve classes,
- // as this may throw an exception, which is not supported by the
- // Generic JNI trampoline at this stage; instead, method's
- // annotations' classes are looked up in the bootstrap class
- // loader's resolved types (which won't trigger an exception).
bool critical_native = called->IsAnnotatedWithCriticalNative();
- // ArtMethod::IsAnnotatedWithCriticalNative should not throw
- // an exception; clear it if it happened anyway.
- // TODO: Revisit this code path and turn this into a CHECK(!self->IsExceptionPending()).
- if (self->IsExceptionPending()) {
- self->ClearException();
- }
bool fast_native = called->IsAnnotatedWithFastNative();
- // ArtMethod::IsAnnotatedWithFastNative should not throw
- // an exception; clear it if it happened anyway.
- // TODO: Revisit this code path and turn this into a CHECK(!self->IsExceptionPending()).
- if (self->IsExceptionPending()) {
- self->ClearException();
- }
bool normal_native = !critical_native && !fast_native;
- // Restore the initial ArtMethod pointer at `*sp`.
- *sp = called;
// Run the visitor and update sp.
BuildGenericJniFrameVisitor visitor(self,
diff --git a/runtime/interpreter/interpreter_switch_impl.cc b/runtime/interpreter/interpreter_switch_impl.cc
index dcfe25b..b191dd7 100644
--- a/runtime/interpreter/interpreter_switch_impl.cc
+++ b/runtime/interpreter/interpreter_switch_impl.cc
@@ -196,20 +196,7 @@
inst = inst->Next_1xx();
break;
case Instruction::MOVE_RESULT_OBJECT:
- if (UNLIKELY(instrumentation->HasDexPcListeners())) {
- // Special case the preamble to save and restore the result object. It could move
- // during DexPcMovedEvent.
- // Note that ideally we should have the result object be visible to GC as soon as it
- // is returned, but that involves pretty heave surgery to the interpreter and the runtime
- // that it may not be worth it. The way it is currently written, there is an implicit
- // assumption the result register is updated last in the leaf method, and all methods
- // in-between just return.
- StackHandleScope<1> hs(self);
- Handle<mirror::Object> result_object(hs.NewHandle(result_register.GetL()));
- instrumentation->DexPcMovedEvent(self, shadow_frame.GetThisObject(code_item->ins_size_),
- shadow_frame.GetMethod(), dex_pc);
- result_register.SetL(result_object.Get());
- }
+ PREAMBLE();
shadow_frame.SetVRegReference(inst->VRegA_11x(inst_data), result_register.GetL());
inst = inst->Next_1xx();
break;
diff --git a/test/656-annotation-lookup-generic-jni/expected.txt b/test/656-annotation-lookup-generic-jni/expected.txt
deleted file mode 100644
index 4519c7e..0000000
--- a/test/656-annotation-lookup-generic-jni/expected.txt
+++ /dev/null
@@ -1,3 +0,0 @@
-JNI_OnLoad called
-Java_Test_nativeMethodWithAnnotation
-passed
diff --git a/test/656-annotation-lookup-generic-jni/info.txt b/test/656-annotation-lookup-generic-jni/info.txt
deleted file mode 100644
index ddc1930..0000000
--- a/test/656-annotation-lookup-generic-jni/info.txt
+++ /dev/null
@@ -1,5 +0,0 @@
-Non-regression test for b/38454151, where the invocation of a native
-method with an annotatation through Generic JNI would crash the
-Generic JNI trampoline because it would throw and exception when
-trying to resolve the annotation (during the CriticalNative/FastNative
-optimization annotation lookup).
diff --git a/test/656-annotation-lookup-generic-jni/src-ex/DummyAnnotation.java b/test/656-annotation-lookup-generic-jni/src-ex/DummyAnnotation.java
deleted file mode 100644
index 6caac66..0000000
--- a/test/656-annotation-lookup-generic-jni/src-ex/DummyAnnotation.java
+++ /dev/null
@@ -1,17 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-public @interface DummyAnnotation {}
diff --git a/test/656-annotation-lookup-generic-jni/src-ex/Test.java b/test/656-annotation-lookup-generic-jni/src-ex/Test.java
deleted file mode 100644
index 838b4fe..0000000
--- a/test/656-annotation-lookup-generic-jni/src-ex/Test.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-public class Test {
-
- public static void initialize(String libname) {
- // Load test native library to get access to the implementation of
- // Test.nativeMethodWithAnnotation.
- System.loadLibrary(libname);
- }
-
- @DummyAnnotation
- public static native void nativeMethodWithAnnotation();
-
-}
diff --git a/test/656-annotation-lookup-generic-jni/src/Main.java b/test/656-annotation-lookup-generic-jni/src/Main.java
deleted file mode 100644
index 01b288a..0000000
--- a/test/656-annotation-lookup-generic-jni/src/Main.java
+++ /dev/null
@@ -1,76 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-import dalvik.system.InMemoryDexClassLoader;
-
-import java.io.InputStream;
-import java.lang.reflect.Method;
-import java.nio.ByteBuffer;
-import java.util.zip.ZipEntry;
-import java.util.zip.ZipFile;
-
-public class Main {
-
- public static void main(String[] args) throws Exception {
- // Extract Dex file contents from the secondary Jar file.
- String jarFilename =
- System.getenv("DEX_LOCATION") + "/656-annotation-lookup-generic-jni-ex.jar";
- ZipFile zipFile = new ZipFile(jarFilename);
- ZipEntry zipEntry = zipFile.getEntry("classes.dex");
- InputStream inputStream = zipFile.getInputStream(zipEntry);
- int dexFileSize = (int) zipEntry.getSize();
- byte[] dexFileContents = new byte[dexFileSize];
- inputStream.read(dexFileContents, 0, dexFileSize);
-
- // Create class loader from secondary Dex file.
- ByteBuffer dexBuffer = ByteBuffer.wrap(dexFileContents);
- ClassLoader classLoader = createUnquickenedDexClassLoader(dexBuffer);
-
- // Load and initialize the Test class.
- Class<?> testClass = classLoader.loadClass("Test");
- Method initialize = testClass.getMethod("initialize", String.class);
- initialize.invoke(null, args[0]);
-
- // Invoke Test.nativeMethodWithAnnotation().
- Method nativeMethodWithAnnotation = testClass.getMethod("nativeMethodWithAnnotation");
- // Invoking the native method Test.nativeMethodWithAnnotation used
- // to crash the Generic JNI trampoline during the resolution of
- // the method's annotations (DummyAnnotation) (see b/38454151).
- nativeMethodWithAnnotation.invoke(null);
-
- zipFile.close();
- System.out.println("passed");
- }
-
- // Create a class loader loading a Dex file in memory
- // *without creating an Oat file*. This way, the Dex file won't be
- // quickened and JNI stubs won't be compiled, thus forcing the use
- // of Generic JNI when invoking the native method
- // Test.nativeMethodWithAnnotation.
- static ClassLoader createUnquickenedDexClassLoader(ByteBuffer dexBuffer) {
- InMemoryDexClassLoader cl = new InMemoryDexClassLoader(dexBuffer, getBootClassLoader());
- return cl;
- }
-
- static ClassLoader getBootClassLoader() {
- ClassLoader cl = Main.class.getClassLoader();
- while (cl.getParent() != null) {
- cl = cl.getParent();
- }
- return cl;
- }
-
-}
diff --git a/test/656-annotation-lookup-generic-jni/test.cc b/test/656-annotation-lookup-generic-jni/test.cc
deleted file mode 100644
index c8aa2af..0000000
--- a/test/656-annotation-lookup-generic-jni/test.cc
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include "jni.h"
-
-#include <iostream>
-
-namespace art {
-
-// Native method annotated with `DummyAnnotation` in Java source.
-extern "C" JNIEXPORT void JNICALL Java_Test_nativeMethodWithAnnotation(JNIEnv*, jclass) {
- std::cout << "Java_Test_nativeMethodWithAnnotation" << std::endl;
-}
-
-} // namespace art
diff --git a/test/657-branches/expected.txt b/test/657-branches/expected.txt
deleted file mode 100644
index d9fd864..0000000
--- a/test/657-branches/expected.txt
+++ /dev/null
@@ -1 +0,0 @@
-Hello World: 4.0
diff --git a/test/657-branches/info.txt b/test/657-branches/info.txt
deleted file mode 100644
index 84a2bb9..0000000
--- a/test/657-branches/info.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-Regression test for the ARM backend, which used to have a bug
-handling branches fallthrough.
diff --git a/test/657-branches/src/Main.java b/test/657-branches/src/Main.java
deleted file mode 100644
index 2b62c5f..0000000
--- a/test/657-branches/src/Main.java
+++ /dev/null
@@ -1,47 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-public class Main {
-
- public static void foo(float f) {
- // The reason this used to break:
- // 1) We inline the 'foo' call, so blocks now only contain HLoadClass instructions.
- // 2) We then run the select_generator pass, which cannot change the
- // if/else because blocks contain instructions.
- // 3) We run GVN which will remove the HLoadClass instructions in the blocks.
- // 4) At code generation, we are in the unlikely situation that a diamond shape
- // contains no instruction (usually removed by select_generator). This used
- // to trip the ARM code generators.
- if (f < 1.2f) {
- foo(Main.class, Object.class);
- if (f < 0.2f) {
- foo(Main.class, Object.class);
- } else {
- foo(Main.class, Object.class);
- }
- } else {
- System.out.println("Hello World: " + f);
- }
- }
-
- public static void foo(Object a, Object b) {}
-
- public static void main(String[] args) {
- foo(0f);
- foo(4f);
- foo(0.1f);
- }
-}
diff --git a/test/658-fp-read-barrier/expected.txt b/test/658-fp-read-barrier/expected.txt
deleted file mode 100644
index e69de29..0000000
--- a/test/658-fp-read-barrier/expected.txt
+++ /dev/null
diff --git a/test/658-fp-read-barrier/info.txt b/test/658-fp-read-barrier/info.txt
deleted file mode 100644
index 26ecb60..0000000
--- a/test/658-fp-read-barrier/info.txt
+++ /dev/null
@@ -1,2 +0,0 @@
-Regression test for the read barrier implementation in ARM64,
-which used to not restore floating point registers.
diff --git a/test/658-fp-read-barrier/src/Main.java b/test/658-fp-read-barrier/src/Main.java
deleted file mode 100644
index c2bd10d..0000000
--- a/test/658-fp-read-barrier/src/Main.java
+++ /dev/null
@@ -1,136 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-public class Main {
- static volatile boolean done = false;
-
- public static void main(String[] args) {
- // Run a thread for 30 seconds, allocating memory and triggering garbage
- // collection.
- // Time is limited to 30 seconds to not make this test too long. The test used
- // to trigger the failure around 1 every 10 runs.
- Thread t = new Thread() {
- public void run() {
- long time = System.currentTimeMillis();
- while (System.currentTimeMillis() - time < 30000) {
- for (int j = 0; j < 10000; j++) {
- o = new Object[1000];
- }
- Runtime.getRuntime().gc();
- Thread.yield();
- }
- Main.done = true;
- }
- Object o;
- };
- // Make the thread a daemon to quit early in case of an
- // exception throw below.
- t.setDaemon(true);
- t.start();
-
- // Run 'foo' as long as the test runs.
- while (!done) {
- double res = foo(staticMain);
- if (res != 529.0) {
- throw new Error("Unexpected result " + res);
- }
- }
- }
-
- public static double foo(Main main) {
- // Use up all D registers on arm64.
- double d1 = main.field1;
- double d2 = main.field2;
- double d3 = main.field3;
- double d4 = main.field4;
- double d5 = main.field5;
- double d6 = main.field6;
- double d7 = main.field7;
- double d8 = main.field8;
- double d9 = main.field9;
- double d10 = main.field10;
- double d11 = main.field11;
- double d12 = main.field12;
- double d13 = main.field13;
- double d14 = main.field14;
- double d15 = main.field15;
- double d16 = main.field16;
- double d17 = main.field17;
- double d18 = main.field18;
- double d19 = main.field19;
- double d20 = main.field20;
- double d21 = main.field21;
- double d22 = main.field22;
- double d23 = main.field23;
- double d24 = main.field24;
- double d25 = main.field25;
- double d26 = main.field26;
- double d27 = main.field27;
- double d28 = main.field28;
- double d29 = main.field29;
- double d30 = main.field30;
- double d31 = main.field31;
- double d32 = main.field32;
-
- // Trigger a read barrier. This used to make the test trip on ARM64 as
- // the read barrier stub used to not restore the D registers.
- double p = main.objectField.field1;
-
- return p + d1 + d2 + d3 + d4 + d5 + d6 + d7 + d8 + d9 + d10 + d11 + d12 + d13 + d14 + d15 + d16 + d17 + d18 + d19 + d20 + d21 + d22 + d23 + d24 + d25 + d26 + d27 + d28 + d29 + d30 + d31 + d32;
- }
-
- // Initialize objects here and not in 'main' to avoid having
- // these objects in roots.
- public static Main staticMain = new Main();
- static {
- staticMain.objectField = new Main();
- }
-
- public Main objectField;
-
- public double field1 = 1.0;
- public double field2 = 2.0;
- public double field3 = 3.0;
- public double field4 = 4.0;
- public double field5 = 5.0;
- public double field6 = 6.0;
- public double field7 = 7.0;
- public double field8 = 8.0;
- public double field9 = 9.0;
- public double field10 = 10.0;
- public double field11 = 11.0;
- public double field12 = 12.0;
- public double field13 = 13.0;
- public double field14 = 14.0;
- public double field15 = 15.0;
- public double field16 = 16.0;
- public double field17 = 17.0;
- public double field18 = 18.0;
- public double field19 = 19.0;
- public double field20 = 20.0;
- public double field21 = 21.0;
- public double field22 = 22.0;
- public double field23 = 23.0;
- public double field24 = 24.0;
- public double field25 = 25.0;
- public double field26 = 26.0;
- public double field27 = 27.0;
- public double field28 = 28.0;
- public double field29 = 29.0;
- public double field30 = 30.0;
- public double field31 = 31.0;
- public double field32 = 32.0;
-}
diff --git a/test/911-get-stack-trace/src/art/PrintThread.java b/test/911-get-stack-trace/src/art/PrintThread.java
index fee5ba0..d8b3cbc 100644
--- a/test/911-get-stack-trace/src/art/PrintThread.java
+++ b/test/911-get-stack-trace/src/art/PrintThread.java
@@ -42,7 +42,7 @@
// may not exist depending on the environment.
public final static String IGNORE_THREAD_NAME_REGEX =
"Binder:|RenderThread|hwuiTask|Jit thread pool worker|Instr:|JDWP|Profile Saver|main|" +
- "queued-work-looper";
+ "queued-work-looper|InstrumentationConnectionThread";
public final static Matcher IGNORE_THREADS =
Pattern.compile(IGNORE_THREAD_NAME_REGEX).matcher("");
diff --git a/test/912-classes/expected.txt b/test/912-classes/expected.txt
index 9dcc5f9..7ad5d60 100644
--- a/test/912-classes/expected.txt
+++ b/test/912-classes/expected.txt
@@ -56,7 +56,7 @@
boot <- 1+2 (A,B)
[class A, class B, class java.lang.Object]
-[37, 0]
+[35, 0]
B, false
Load: LB; on ClassEvents
diff --git a/test/912-classes/src/art/Test912.java b/test/912-classes/src/art/Test912.java
index 9896eac..cea42a6 100644
--- a/test/912-classes/src/art/Test912.java
+++ b/test/912-classes/src/art/Test912.java
@@ -19,8 +19,10 @@
import java.lang.ref.Reference;
import java.lang.reflect.Constructor;
import java.lang.reflect.Proxy;
+import java.nio.ByteBuffer;
import java.util.ArrayList;
import java.util.Arrays;
+import java.util.Base64;
import java.util.Comparator;
public class Test912 {
@@ -214,8 +216,34 @@
}
}
- private static void testClassVersion() {
- System.out.println(Arrays.toString(getClassVersion(Main.class)));
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+ private static void testClassVersion() throws Exception {
+ Class<?> class_loader_class = Class.forName("dalvik.system.InMemoryDexClassLoader");
+ Constructor<?> ctor = class_loader_class.getConstructor(ByteBuffer.class, ClassLoader.class);
+ Class target = ((ClassLoader)ctor.newInstance(
+ ByteBuffer.wrap(DEX_BYTES), Test912.class.getClassLoader())).loadClass("Transform");
+ System.out.println(Arrays.toString(getClassVersion(target)));
}
private static void testClassEvents() throws Exception {
diff --git a/test/Android.bp b/test/Android.bp
index 2d682ed..1679669 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -393,7 +393,6 @@
"626-const-class-linking/clear_dex_cache_types.cc",
"642-fp-callees/fp_callees.cc",
"647-jni-get-field-id/get_field_id.cc",
- "656-annotation-lookup-generic-jni/test.cc"
],
shared_libs: [
"libbacktrace",
