Merge "Fix arm64 and x86_64 code generator assertion"
diff --git a/compiler/Android.bp b/compiler/Android.bp
index d57f301..b444fff 100644
--- a/compiler/Android.bp
+++ b/compiler/Android.bp
@@ -391,6 +391,7 @@
mips64: {
srcs: [
"linker/mips64/relative_patcher_mips64_test.cc",
+ "utils/mips64/managed_register_mips64_test.cc",
],
},
x86: {
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index 808e28c..538fe93 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -70,10 +70,6 @@
return *unit_.GetDexFile();
}
- bool PerformOptimizations() const {
- return dex_to_dex_compilation_level_ >= DexToDexCompilationLevel::kOptimize;
- }
-
// Compiles a RETURN-VOID into a RETURN-VOID-BARRIER within a constructor where
// a barrier is required.
void CompileReturnVoid(Instruction* inst, uint32_t dex_pc);
@@ -114,7 +110,7 @@
};
void DexCompiler::Compile() {
- DCHECK_GE(dex_to_dex_compilation_level_, DexToDexCompilationLevel::kRequired);
+ DCHECK_EQ(dex_to_dex_compilation_level_, DexToDexCompilationLevel::kOptimize);
const DexFile::CodeItem* code_item = unit_.GetCodeItem();
const uint16_t* insns = code_item->insns_;
const uint32_t insns_size = code_item->insns_size_in_code_units_;
@@ -221,7 +217,7 @@
}
Instruction* DexCompiler::CompileCheckCast(Instruction* inst, uint32_t dex_pc) {
- if (!kEnableCheckCastEllision || !PerformOptimizations()) {
+ if (!kEnableCheckCastEllision) {
return inst;
}
if (!driver_.IsSafeCast(&unit_, dex_pc)) {
@@ -254,7 +250,7 @@
uint32_t dex_pc,
Instruction::Code new_opcode,
bool is_put) {
- if (!kEnableQuickening || !PerformOptimizations()) {
+ if (!kEnableQuickening) {
return;
}
uint32_t field_idx = inst->VRegC_22c();
@@ -279,7 +275,7 @@
void DexCompiler::CompileInvokeVirtual(Instruction* inst, uint32_t dex_pc,
Instruction::Code new_opcode, bool is_range) {
- if (!kEnableQuickening || !PerformOptimizations()) {
+ if (!kEnableQuickening) {
return;
}
uint32_t method_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
diff --git a/compiler/dex/dex_to_dex_compiler.h b/compiler/dex/dex_to_dex_compiler.h
index 00c596d..87ddb39 100644
--- a/compiler/dex/dex_to_dex_compiler.h
+++ b/compiler/dex/dex_to_dex_compiler.h
@@ -34,8 +34,7 @@
enum class DexToDexCompilationLevel {
kDontDexToDexCompile, // Only meaning wrt image time interpretation.
- kRequired, // Dex-to-dex compilation required for correctness.
- kOptimize // Perform required transformation and peep-hole optimizations.
+ kOptimize // Perform peep-hole optimizations.
};
std::ostream& operator<<(std::ostream& os, const DexToDexCompilationLevel& rhs);
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index 9950987..e823f67 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -532,16 +532,13 @@
if (driver.GetCompilerOptions().GetDebuggable()) {
// We are debuggable so definitions of classes might be changed. We don't want to do any
// optimizations that could break that.
- max_level = optimizer::DexToDexCompilationLevel::kRequired;
+ max_level = optimizer::DexToDexCompilationLevel::kDontDexToDexCompile;
}
if (klass->IsVerified()) {
// Class is verified so we can enable DEX-to-DEX compilation for performance.
return max_level;
- } else if (klass->ShouldVerifyAtRuntime()) {
- // Class verification has soft-failed. Anyway, ensure at least correctness.
- return optimizer::DexToDexCompilationLevel::kRequired;
} else {
- // Class verification has failed: do not run DEX-to-DEX compilation.
+ // Class verification has failed: do not run DEX-to-DEX optimizations.
return optimizer::DexToDexCompilationLevel::kDontDexToDexCompile;
}
}
@@ -611,7 +608,7 @@
dex_file,
(verified_method != nullptr)
? dex_to_dex_compilation_level
- : optimizer::DexToDexCompilationLevel::kRequired);
+ : optimizer::DexToDexCompilationLevel::kDontDexToDexCompile);
}
} else if ((access_flags & kAccNative) != 0) {
// Are we extracting only and have support for generic JNI down calls?
diff --git a/compiler/driver/compiler_options.cc b/compiler/driver/compiler_options.cc
index 34ad1c5..a0c0a2a 100644
--- a/compiler/driver/compiler_options.cc
+++ b/compiler/driver/compiler_options.cc
@@ -27,7 +27,6 @@
small_method_threshold_(kDefaultSmallMethodThreshold),
tiny_method_threshold_(kDefaultTinyMethodThreshold),
num_dex_methods_threshold_(kDefaultNumDexMethodsThreshold),
- inline_depth_limit_(kUnsetInlineDepthLimit),
inline_max_code_units_(kUnsetInlineMaxCodeUnits),
no_inline_from_(nullptr),
boot_image_(false),
@@ -62,7 +61,6 @@
size_t small_method_threshold,
size_t tiny_method_threshold,
size_t num_dex_methods_threshold,
- size_t inline_depth_limit,
size_t inline_max_code_units,
const std::vector<const DexFile*>* no_inline_from,
double top_k_profile_threshold,
@@ -86,7 +84,6 @@
small_method_threshold_(small_method_threshold),
tiny_method_threshold_(tiny_method_threshold),
num_dex_methods_threshold_(num_dex_methods_threshold),
- inline_depth_limit_(inline_depth_limit),
inline_max_code_units_(inline_max_code_units),
no_inline_from_(no_inline_from),
boot_image_(false),
@@ -130,10 +127,6 @@
ParseUintOption(option, "--num-dex-methods", &num_dex_methods_threshold_, Usage);
}
-void CompilerOptions::ParseInlineDepthLimit(const StringPiece& option, UsageFn Usage) {
- ParseUintOption(option, "--inline-depth-limit", &inline_depth_limit_, Usage);
-}
-
void CompilerOptions::ParseInlineMaxCodeUnits(const StringPiece& option, UsageFn Usage) {
ParseUintOption(option, "--inline-max-code-units", &inline_max_code_units_, Usage);
}
@@ -183,8 +176,6 @@
ParseTinyMethodMax(option, Usage);
} else if (option.starts_with("--num-dex-methods=")) {
ParseNumDexMethods(option, Usage);
- } else if (option.starts_with("--inline-depth-limit=")) {
- ParseInlineDepthLimit(option, Usage);
} else if (option.starts_with("--inline-max-code-units=")) {
ParseInlineMaxCodeUnits(option, Usage);
} else if (option == "--generate-debug-info" || option == "-g") {
diff --git a/compiler/driver/compiler_options.h b/compiler/driver/compiler_options.h
index 2e3e55f..2376fbf 100644
--- a/compiler/driver/compiler_options.h
+++ b/compiler/driver/compiler_options.h
@@ -46,15 +46,9 @@
static constexpr double kDefaultTopKProfileThreshold = 90.0;
static const bool kDefaultGenerateDebugInfo = false;
static const bool kDefaultGenerateMiniDebugInfo = false;
- static const size_t kDefaultInlineDepthLimit = 3;
static const size_t kDefaultInlineMaxCodeUnits = 32;
- static constexpr size_t kUnsetInlineDepthLimit = -1;
static constexpr size_t kUnsetInlineMaxCodeUnits = -1;
- // Default inlining settings when the space filter is used.
- static constexpr size_t kSpaceFilterInlineDepthLimit = 3;
- static constexpr size_t kSpaceFilterInlineMaxCodeUnits = 10;
-
CompilerOptions();
~CompilerOptions();
@@ -64,7 +58,6 @@
size_t small_method_threshold,
size_t tiny_method_threshold,
size_t num_dex_methods_threshold,
- size_t inline_depth_limit,
size_t inline_max_code_units,
const std::vector<const DexFile*>* no_inline_from,
double top_k_profile_threshold,
@@ -155,13 +148,6 @@
return num_dex_methods_threshold_;
}
- size_t GetInlineDepthLimit() const {
- return inline_depth_limit_;
- }
- void SetInlineDepthLimit(size_t limit) {
- inline_depth_limit_ = limit;
- }
-
size_t GetInlineMaxCodeUnits() const {
return inline_max_code_units_;
}
@@ -275,7 +261,6 @@
void ParseDumpInitFailures(const StringPiece& option, UsageFn Usage);
void ParseDumpCfgPasses(const StringPiece& option, UsageFn Usage);
void ParseInlineMaxCodeUnits(const StringPiece& option, UsageFn Usage);
- void ParseInlineDepthLimit(const StringPiece& option, UsageFn Usage);
void ParseNumDexMethods(const StringPiece& option, UsageFn Usage);
void ParseTinyMethodMax(const StringPiece& option, UsageFn Usage);
void ParseSmallMethodMax(const StringPiece& option, UsageFn Usage);
@@ -289,7 +274,6 @@
size_t small_method_threshold_;
size_t tiny_method_threshold_;
size_t num_dex_methods_threshold_;
- size_t inline_depth_limit_;
size_t inline_max_code_units_;
// Dex files from which we should not inline code.
diff --git a/compiler/image_test.cc b/compiler/image_test.cc
index 7ee494a..897d819 100644
--- a/compiler/image_test.cc
+++ b/compiler/image_test.cc
@@ -363,7 +363,6 @@
}
CreateCompilerDriver(Compiler::kOptimizing, kRuntimeISA, kIsTargetBuild ? 2U : 16U);
// Set inline filter values.
- compiler_options_->SetInlineDepthLimit(CompilerOptions::kDefaultInlineDepthLimit);
compiler_options_->SetInlineMaxCodeUnits(CompilerOptions::kDefaultInlineMaxCodeUnits);
image_classes_.clear();
if (!extra_dex.empty()) {
diff --git a/compiler/jit/jit_compiler.cc b/compiler/jit/jit_compiler.cc
index 3ae7974..ad951bc 100644
--- a/compiler/jit/jit_compiler.cc
+++ b/compiler/jit/jit_compiler.cc
@@ -97,7 +97,6 @@
CompilerOptions::kDefaultSmallMethodThreshold,
CompilerOptions::kDefaultTinyMethodThreshold,
CompilerOptions::kDefaultNumDexMethodsThreshold,
- CompilerOptions::kDefaultInlineDepthLimit,
CompilerOptions::kDefaultInlineMaxCodeUnits,
/* no_inline_from */ nullptr,
CompilerOptions::kDefaultTopKProfileThreshold,
@@ -177,10 +176,6 @@
jit_logger_.reset(new JitLogger());
jit_logger_->OpenLog();
}
-
- size_t inline_depth_limit = compiler_driver_->GetCompilerOptions().GetInlineDepthLimit();
- DCHECK_LT(thread_count * inline_depth_limit, std::numeric_limits<uint16_t>::max())
- << "ProfilingInfo's inline counter can potentially overflow";
}
JitCompiler::~JitCompiler() {
diff --git a/compiler/optimizing/bounds_check_elimination.cc b/compiler/optimizing/bounds_check_elimination.cc
index 2ee4db9..476906a 100644
--- a/compiler/optimizing/bounds_check_elimination.cc
+++ b/compiler/optimizing/bounds_check_elimination.cc
@@ -528,7 +528,8 @@
has_dom_based_dynamic_bce_(false),
initial_block_size_(graph->GetBlocks().size()),
side_effects_(side_effects),
- induction_range_(induction_analysis) {}
+ induction_range_(induction_analysis),
+ next_(nullptr) {}
void VisitBasicBlock(HBasicBlock* block) OVERRIDE {
DCHECK(!IsAddedBlock(block));
@@ -1618,8 +1619,8 @@
void InsertDeoptInLoop(HLoopInformation* loop, HBasicBlock* block, HInstruction* condition) {
HInstruction* suspend = loop->GetSuspendCheck();
block->InsertInstructionBefore(condition, block->GetLastInstruction());
- HDeoptimize* deoptimize =
- new (GetGraph()->GetArena()) HDeoptimize(condition, suspend->GetDexPc());
+ HDeoptimize* deoptimize = new (GetGraph()->GetArena()) HDeoptimize(
+ GetGraph()->GetArena(), condition, HDeoptimize::Kind::kBCE, suspend->GetDexPc());
block->InsertInstructionBefore(deoptimize, block->GetLastInstruction());
if (suspend->HasEnvironment()) {
deoptimize->CopyEnvironmentFromWithLoopPhiAdjustment(
@@ -1631,8 +1632,8 @@
void InsertDeoptInBlock(HBoundsCheck* bounds_check, HInstruction* condition) {
HBasicBlock* block = bounds_check->GetBlock();
block->InsertInstructionBefore(condition, bounds_check);
- HDeoptimize* deoptimize =
- new (GetGraph()->GetArena()) HDeoptimize(condition, bounds_check->GetDexPc());
+ HDeoptimize* deoptimize = new (GetGraph()->GetArena()) HDeoptimize(
+ GetGraph()->GetArena(), condition, HDeoptimize::Kind::kBCE, bounds_check->GetDexPc());
block->InsertInstructionBefore(deoptimize, bounds_check);
deoptimize->CopyEnvironmentFrom(bounds_check->GetEnvironment());
}
diff --git a/compiler/optimizing/cha_guard_optimization.cc b/compiler/optimizing/cha_guard_optimization.cc
index fe42301..048073e 100644
--- a/compiler/optimizing/cha_guard_optimization.cc
+++ b/compiler/optimizing/cha_guard_optimization.cc
@@ -36,7 +36,8 @@
: HGraphVisitor(graph),
block_has_cha_guard_(GetGraph()->GetBlocks().size(),
0,
- graph->GetArena()->Adapter(kArenaAllocCHA)) {
+ graph->GetArena()->Adapter(kArenaAllocCHA)),
+ instruction_iterator_(nullptr) {
number_of_guards_to_visit_ = GetGraph()->GetNumberOfCHAGuards();
DCHECK_NE(number_of_guards_to_visit_, 0u);
// Will recount number of guards during guard optimization.
@@ -201,8 +202,8 @@
HInstruction* suspend = loop_info->GetSuspendCheck();
// Need a new deoptimize instruction that copies the environment
// of the suspend instruction for the loop.
- HDeoptimize* deoptimize =
- new (GetGraph()->GetArena()) HDeoptimize(compare, suspend->GetDexPc());
+ HDeoptimize* deoptimize = new (GetGraph()->GetArena()) HDeoptimize(
+ GetGraph()->GetArena(), compare, HDeoptimize::Kind::kInline, suspend->GetDexPc());
pre_header->InsertInstructionBefore(deoptimize, pre_header->GetLastInstruction());
deoptimize->CopyEnvironmentFromWithLoopPhiAdjustment(
suspend->GetEnvironment(), loop_info->GetHeader());
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index caea250..d7cc577 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -1134,7 +1134,7 @@
instruction_->IsArrayGet() ||
instruction_->IsInstanceOf() ||
instruction_->IsCheckCast() ||
- (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
<< "Unexpected instruction in read barrier for heap reference slow path: "
<< instruction_->DebugName();
// The read barrier instrumentation of object ArrayGet
@@ -1602,14 +1602,20 @@
}
}
-static Condition GenerateLongTestConstant(HCondition* condition,
- bool invert,
- CodeGeneratorARM* codegen) {
+static std::pair<Condition, Condition> GenerateLongTestConstant(HCondition* condition,
+ bool invert,
+ CodeGeneratorARM* codegen) {
DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
const LocationSummary* const locations = condition->GetLocations();
- IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
- Condition ret = EQ;
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+
+ if (invert) {
+ std::swap(cond, opposite);
+ }
+
+ std::pair<Condition, Condition> ret;
const Location left = locations->InAt(0);
const Location right = locations->InAt(1);
@@ -1629,22 +1635,26 @@
__ CmpConstant(left_high, High32Bits(value));
__ it(EQ);
__ cmp(left_low, ShifterOperand(Low32Bits(value)), EQ);
- ret = ARMUnsignedCondition(cond);
+ ret = std::make_pair(ARMUnsignedCondition(cond), ARMUnsignedCondition(opposite));
break;
case kCondLE:
case kCondGT:
// Trivially true or false.
if (value == std::numeric_limits<int64_t>::max()) {
__ cmp(left_low, ShifterOperand(left_low));
- ret = cond == kCondLE ? EQ : NE;
+ ret = cond == kCondLE ? std::make_pair(EQ, NE) : std::make_pair(NE, EQ);
break;
}
if (cond == kCondLE) {
+ DCHECK_EQ(opposite, kCondGT);
cond = kCondLT;
+ opposite = kCondGE;
} else {
DCHECK_EQ(cond, kCondGT);
+ DCHECK_EQ(opposite, kCondLE);
cond = kCondGE;
+ opposite = kCondLT;
}
value++;
@@ -1653,7 +1663,7 @@
case kCondLT:
__ CmpConstant(left_low, Low32Bits(value));
__ sbcs(IP, left_high, ShifterOperand(High32Bits(value)));
- ret = ARMCondition(cond);
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
break;
default:
LOG(FATAL) << "Unreachable";
@@ -1663,14 +1673,20 @@
return ret;
}
-static Condition GenerateLongTest(HCondition* condition,
- bool invert,
- CodeGeneratorARM* codegen) {
+static std::pair<Condition, Condition> GenerateLongTest(HCondition* condition,
+ bool invert,
+ CodeGeneratorARM* codegen) {
DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
const LocationSummary* const locations = condition->GetLocations();
- IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
- Condition ret = EQ;
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+
+ if (invert) {
+ std::swap(cond, opposite);
+ }
+
+ std::pair<Condition, Condition> ret;
Location left = locations->InAt(0);
Location right = locations->InAt(1);
@@ -1689,15 +1705,19 @@
__ cmp(left.AsRegisterPairLow<Register>(),
ShifterOperand(right.AsRegisterPairLow<Register>()),
EQ);
- ret = ARMUnsignedCondition(cond);
+ ret = std::make_pair(ARMUnsignedCondition(cond), ARMUnsignedCondition(opposite));
break;
case kCondLE:
case kCondGT:
if (cond == kCondLE) {
+ DCHECK_EQ(opposite, kCondGT);
cond = kCondGE;
+ opposite = kCondLT;
} else {
DCHECK_EQ(cond, kCondGT);
+ DCHECK_EQ(opposite, kCondLE);
cond = kCondLT;
+ opposite = kCondGE;
}
std::swap(left, right);
@@ -1709,7 +1729,7 @@
__ sbcs(IP,
left.AsRegisterPairHigh<Register>(),
ShifterOperand(right.AsRegisterPairHigh<Register>()));
- ret = ARMCondition(cond);
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
break;
default:
LOG(FATAL) << "Unreachable";
@@ -1719,90 +1739,83 @@
return ret;
}
-static Condition GenerateTest(HInstruction* instruction,
- Location loc,
- bool invert,
- CodeGeneratorARM* codegen) {
- DCHECK(!instruction->IsConstant());
+static std::pair<Condition, Condition> GenerateTest(HCondition* condition,
+ bool invert,
+ CodeGeneratorARM* codegen) {
+ const LocationSummary* const locations = condition->GetLocations();
+ const Primitive::Type type = condition->GetLeft()->GetType();
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+ std::pair<Condition, Condition> ret;
+ const Location right = locations->InAt(1);
- Condition ret = invert ? EQ : NE;
+ if (invert) {
+ std::swap(cond, opposite);
+ }
- if (IsBooleanValueOrMaterializedCondition(instruction)) {
- __ CmpConstant(loc.AsRegister<Register>(), 0);
+ if (type == Primitive::kPrimLong) {
+ ret = locations->InAt(1).IsConstant()
+ ? GenerateLongTestConstant(condition, invert, codegen)
+ : GenerateLongTest(condition, invert, codegen);
+ } else if (Primitive::IsFloatingPointType(type)) {
+ GenerateVcmp(condition, codegen);
+ __ vmstat();
+ ret = std::make_pair(ARMFPCondition(cond, condition->IsGtBias()),
+ ARMFPCondition(opposite, condition->IsGtBias()));
} else {
- HCondition* const condition = instruction->AsCondition();
- const LocationSummary* const locations = condition->GetLocations();
- const Primitive::Type type = condition->GetLeft()->GetType();
- const IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
- const Location right = locations->InAt(1);
+ DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
- if (type == Primitive::kPrimLong) {
- ret = condition->GetLocations()->InAt(1).IsConstant()
- ? GenerateLongTestConstant(condition, invert, codegen)
- : GenerateLongTest(condition, invert, codegen);
- } else if (Primitive::IsFloatingPointType(type)) {
- GenerateVcmp(condition, codegen);
- __ vmstat();
- ret = ARMFPCondition(cond, condition->IsGtBias());
+ const Register left = locations->InAt(0).AsRegister<Register>();
+
+ if (right.IsRegister()) {
+ __ cmp(left, ShifterOperand(right.AsRegister<Register>()));
} else {
- DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
-
- const Register left = locations->InAt(0).AsRegister<Register>();
-
- if (right.IsRegister()) {
- __ cmp(left, ShifterOperand(right.AsRegister<Register>()));
- } else {
- DCHECK(right.IsConstant());
- __ CmpConstant(left, CodeGenerator::GetInt32ValueOf(right.GetConstant()));
- }
-
- ret = ARMCondition(cond);
+ DCHECK(right.IsConstant());
+ __ CmpConstant(left, CodeGenerator::GetInt32ValueOf(right.GetConstant()));
}
+
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
}
return ret;
}
-static bool CanGenerateTest(HInstruction* condition, ArmAssembler* assembler) {
- if (!IsBooleanValueOrMaterializedCondition(condition)) {
- const HCondition* const cond = condition->AsCondition();
+static bool CanGenerateTest(HCondition* condition, ArmAssembler* assembler) {
+ if (condition->GetLeft()->GetType() == Primitive::kPrimLong) {
+ const LocationSummary* const locations = condition->GetLocations();
+ const IfCondition c = condition->GetCondition();
- if (cond->GetLeft()->GetType() == Primitive::kPrimLong) {
- const LocationSummary* const locations = cond->GetLocations();
- const IfCondition c = cond->GetCondition();
+ if (locations->InAt(1).IsConstant()) {
+ const int64_t value = locations->InAt(1).GetConstant()->AsLongConstant()->GetValue();
+ ShifterOperand so;
- if (locations->InAt(1).IsConstant()) {
- const int64_t value = locations->InAt(1).GetConstant()->AsLongConstant()->GetValue();
- ShifterOperand so;
-
- if (c < kCondLT || c > kCondGE) {
- // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
- // we check that the least significant half of the first input to be compared
- // is in a low register (the other half is read outside an IT block), and
- // the constant fits in an 8-bit unsigned integer, so that a 16-bit CMP
- // encoding can be used.
- if (!ArmAssembler::IsLowRegister(locations->InAt(0).AsRegisterPairLow<Register>()) ||
- !IsUint<8>(Low32Bits(value))) {
- return false;
- }
- } else if (c == kCondLE || c == kCondGT) {
- if (value < std::numeric_limits<int64_t>::max() &&
- !assembler->ShifterOperandCanHold(kNoRegister,
- kNoRegister,
- SBC,
- High32Bits(value + 1),
- kCcSet,
- &so)) {
- return false;
- }
- } else if (!assembler->ShifterOperandCanHold(kNoRegister,
- kNoRegister,
- SBC,
- High32Bits(value),
- kCcSet,
- &so)) {
+ if (c < kCondLT || c > kCondGE) {
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the least significant half of the first input to be compared
+ // is in a low register (the other half is read outside an IT block), and
+ // the constant fits in an 8-bit unsigned integer, so that a 16-bit CMP
+ // encoding can be used.
+ if (!ArmAssembler::IsLowRegister(locations->InAt(0).AsRegisterPairLow<Register>()) ||
+ !IsUint<8>(Low32Bits(value))) {
return false;
}
+ } else if (c == kCondLE || c == kCondGT) {
+ if (value < std::numeric_limits<int64_t>::max() &&
+ !assembler->ShifterOperandCanHold(kNoRegister,
+ kNoRegister,
+ SBC,
+ High32Bits(value + 1),
+ kCcSet,
+ &so)) {
+ return false;
+ }
+ } else if (!assembler->ShifterOperandCanHold(kNoRegister,
+ kNoRegister,
+ SBC,
+ High32Bits(value),
+ kCcSet,
+ &so)) {
+ return false;
}
}
}
@@ -2415,13 +2428,6 @@
void InstructionCodeGeneratorARM::VisitExit(HExit* exit ATTRIBUTE_UNUSED) {
}
-void InstructionCodeGeneratorARM::GenerateFPJumps(HCondition* cond,
- Label* true_label,
- Label* false_label ATTRIBUTE_UNUSED) {
- __ vmstat(); // transfer FP status register to ARM APSR.
- __ b(true_label, ARMFPCondition(cond->GetCondition(), cond->IsGtBias()));
-}
-
void InstructionCodeGeneratorARM::GenerateLongComparesAndJumps(HCondition* cond,
Label* true_label,
Label* false_label) {
@@ -2438,7 +2444,6 @@
// Set the conditions for the test, remembering that == needs to be
// decided using the low words.
- // TODO: consider avoiding jumps with temporary and CMP low+SBC high
switch (if_cond) {
case kCondEQ:
case kCondNE:
@@ -2509,25 +2514,38 @@
void InstructionCodeGeneratorARM::GenerateCompareTestAndBranch(HCondition* condition,
Label* true_target_in,
Label* false_target_in) {
+ if (CanGenerateTest(condition, codegen_->GetAssembler())) {
+ Label* non_fallthrough_target;
+ bool invert;
+
+ if (true_target_in == nullptr) {
+ DCHECK(false_target_in != nullptr);
+ non_fallthrough_target = false_target_in;
+ invert = true;
+ } else {
+ non_fallthrough_target = true_target_in;
+ invert = false;
+ }
+
+ const auto cond = GenerateTest(condition, invert, codegen_);
+
+ __ b(non_fallthrough_target, cond.first);
+
+ if (false_target_in != nullptr && false_target_in != non_fallthrough_target) {
+ __ b(false_target_in);
+ }
+
+ return;
+ }
+
// Generated branching requires both targets to be explicit. If either of the
// targets is nullptr (fallthrough) use and bind `fallthrough_target` instead.
Label fallthrough_target;
Label* true_target = true_target_in == nullptr ? &fallthrough_target : true_target_in;
Label* false_target = false_target_in == nullptr ? &fallthrough_target : false_target_in;
- Primitive::Type type = condition->InputAt(0)->GetType();
- switch (type) {
- case Primitive::kPrimLong:
- GenerateLongComparesAndJumps(condition, true_target, false_target);
- break;
- case Primitive::kPrimFloat:
- case Primitive::kPrimDouble:
- GenerateVcmp(condition, codegen_);
- GenerateFPJumps(condition, true_target, false_target);
- break;
- default:
- LOG(FATAL) << "Unexpected compare type " << type;
- }
+ DCHECK_EQ(condition->InputAt(0)->GetType(), Primitive::kPrimLong);
+ GenerateLongComparesAndJumps(condition, true_target, false_target);
if (false_target != &fallthrough_target) {
__ b(false_target);
@@ -2729,7 +2747,8 @@
}
if (!Primitive::IsFloatingPointType(type) &&
- CanGenerateTest(condition, codegen_->GetAssembler())) {
+ (IsBooleanValueOrMaterializedCondition(condition) ||
+ CanGenerateTest(condition->AsCondition(), codegen_->GetAssembler()))) {
bool invert = false;
if (out.Equals(second)) {
@@ -2753,7 +2772,14 @@
codegen_->MoveLocation(out, src.Equals(first) ? second : first, type);
}
- const Condition cond = GenerateTest(condition, locations->InAt(2), invert, codegen_);
+ std::pair<Condition, Condition> cond;
+
+ if (IsBooleanValueOrMaterializedCondition(condition)) {
+ __ CmpConstant(locations->InAt(2).AsRegister<Register>(), 0);
+ cond = invert ? std::make_pair(EQ, NE) : std::make_pair(NE, EQ);
+ } else {
+ cond = GenerateTest(condition->AsCondition(), invert, codegen_);
+ }
if (out.IsRegister()) {
ShifterOperand operand;
@@ -2765,8 +2791,8 @@
operand = ShifterOperand(src.AsRegister<Register>());
}
- __ it(cond);
- __ mov(out.AsRegister<Register>(), operand, cond);
+ __ it(cond.first);
+ __ mov(out.AsRegister<Register>(), operand, cond.first);
} else {
DCHECK(out.IsRegisterPair());
@@ -2784,10 +2810,10 @@
operand_low = ShifterOperand(src.AsRegisterPairLow<Register>());
}
- __ it(cond);
- __ mov(out.AsRegisterPairLow<Register>(), operand_low, cond);
- __ it(cond);
- __ mov(out.AsRegisterPairHigh<Register>(), operand_high, cond);
+ __ it(cond.first);
+ __ mov(out.AsRegisterPairLow<Register>(), operand_low, cond.first);
+ __ it(cond.first);
+ __ mov(out.AsRegisterPairHigh<Register>(), operand_high, cond.first);
}
return;
@@ -2840,7 +2866,7 @@
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(cond->InputAt(1)));
if (!cond->IsEmittedAtUseSite()) {
- locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
+ locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
}
break;
@@ -2867,51 +2893,44 @@
return;
}
- LocationSummary* locations = cond->GetLocations();
- Location left = locations->InAt(0);
- Location right = locations->InAt(1);
- Register out = locations->Out().AsRegister<Register>();
- Label true_label, false_label;
+ const Register out = cond->GetLocations()->Out().AsRegister<Register>();
- switch (cond->InputAt(0)->GetType()) {
- default: {
- // Integer case.
- if (right.IsRegister()) {
- __ cmp(left.AsRegister<Register>(), ShifterOperand(right.AsRegister<Register>()));
- } else {
- DCHECK(right.IsConstant());
- __ CmpConstant(left.AsRegister<Register>(),
- CodeGenerator::GetInt32ValueOf(right.GetConstant()));
- }
- __ it(ARMCondition(cond->GetCondition()), kItElse);
- __ mov(locations->Out().AsRegister<Register>(), ShifterOperand(1),
- ARMCondition(cond->GetCondition()));
- __ mov(locations->Out().AsRegister<Register>(), ShifterOperand(0),
- ARMCondition(cond->GetOppositeCondition()));
- return;
- }
- case Primitive::kPrimLong:
- GenerateLongComparesAndJumps(cond, &true_label, &false_label);
- break;
- case Primitive::kPrimFloat:
- case Primitive::kPrimDouble:
- GenerateVcmp(cond, codegen_);
- GenerateFPJumps(cond, &true_label, &false_label);
- break;
+ if (ArmAssembler::IsLowRegister(out) && CanGenerateTest(cond, codegen_->GetAssembler())) {
+ const auto condition = GenerateTest(cond, false, codegen_);
+
+ __ it(condition.first);
+ __ mov(out, ShifterOperand(1), condition.first);
+ __ it(condition.second);
+ __ mov(out, ShifterOperand(0), condition.second);
+ return;
}
// Convert the jumps into the result.
Label done_label;
- Label* final_label = codegen_->GetFinalLabel(cond, &done_label);
+ Label* const final_label = codegen_->GetFinalLabel(cond, &done_label);
- // False case: result = 0.
- __ Bind(&false_label);
- __ LoadImmediate(out, 0);
- __ b(final_label);
+ if (cond->InputAt(0)->GetType() == Primitive::kPrimLong) {
+ Label true_label, false_label;
- // True case: result = 1.
- __ Bind(&true_label);
- __ LoadImmediate(out, 1);
+ GenerateLongComparesAndJumps(cond, &true_label, &false_label);
+
+ // False case: result = 0.
+ __ Bind(&false_label);
+ __ LoadImmediate(out, 0);
+ __ b(final_label);
+
+ // True case: result = 1.
+ __ Bind(&true_label);
+ __ LoadImmediate(out, 1);
+ } else {
+ DCHECK(CanGenerateTest(cond, codegen_->GetAssembler()));
+
+ const auto condition = GenerateTest(cond, false, codegen_);
+
+ __ mov(out, ShifterOperand(0), AL, kCcKeep);
+ __ b(final_label, condition.second);
+ __ LoadImmediate(out, 1);
+ }
if (done_label.IsLinked()) {
__ Bind(&done_label);
@@ -7039,14 +7058,16 @@
uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
uint32_t primitive_offset = mirror::Class::PrimitiveTypeOffset().Int32Value();
- Label done, zero;
- Label* final_label = codegen_->GetFinalLabel(instruction, &done);
+ Label done;
+ Label* const final_label = codegen_->GetFinalLabel(instruction, &done);
SlowPathCodeARM* slow_path = nullptr;
// Return 0 if `obj` is null.
// avoid null check if we know obj is not null.
if (instruction->MustDoNullCheck()) {
- __ CompareAndBranchIfZero(obj, &zero);
+ DCHECK_NE(out, obj);
+ __ LoadImmediate(out, 0);
+ __ CompareAndBranchIfZero(obj, final_label);
}
switch (type_check_kind) {
@@ -7058,11 +7079,23 @@
class_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- __ cmp(out, ShifterOperand(cls));
// Classes must be equal for the instanceof to succeed.
- __ b(&zero, NE);
- __ LoadImmediate(out, 1);
- __ b(final_label);
+ __ cmp(out, ShifterOperand(cls));
+ // We speculatively set the result to false without changing the condition
+ // flags, which allows us to avoid some branching later.
+ __ mov(out, ShifterOperand(0), AL, kCcKeep);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (ArmAssembler::IsLowRegister(out)) {
+ __ it(EQ);
+ __ mov(out, ShifterOperand(1), EQ);
+ } else {
+ __ b(final_label, NE);
+ __ LoadImmediate(out, 1);
+ }
+
break;
}
@@ -7084,14 +7117,11 @@
super_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- // If `out` is null, we use it for the result, and jump to `done`.
+ // If `out` is null, we use it for the result, and jump to the final label.
__ CompareAndBranchIfZero(out, final_label);
__ cmp(out, ShifterOperand(cls));
__ b(&loop, NE);
__ LoadImmediate(out, 1);
- if (zero.IsLinked()) {
- __ b(final_label);
- }
break;
}
@@ -7114,14 +7144,32 @@
super_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- __ CompareAndBranchIfNonZero(out, &loop);
- // If `out` is null, we use it for the result, and jump to `done`.
- __ b(final_label);
- __ Bind(&success);
- __ LoadImmediate(out, 1);
- if (zero.IsLinked()) {
+ // This is essentially a null check, but it sets the condition flags to the
+ // proper value for the code that follows the loop, i.e. not `EQ`.
+ __ cmp(out, ShifterOperand(1));
+ __ b(&loop, HS);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (ArmAssembler::IsLowRegister(out)) {
+ // If `out` is null, we use it for the result, and the condition flags
+ // have already been set to `NE`, so the IT block that comes afterwards
+ // (and which handles the successful case) turns into a NOP (instead of
+ // overwriting `out`).
+ __ Bind(&success);
+ // There is only one branch to the `success` label (which is bound to this
+ // IT block), and it has the same condition, `EQ`, so in that case the MOV
+ // is executed.
+ __ it(EQ);
+ __ mov(out, ShifterOperand(1), EQ);
+ } else {
+ // If `out` is null, we use it for the result, and jump to the final label.
__ b(final_label);
+ __ Bind(&success);
+ __ LoadImmediate(out, 1);
}
+
break;
}
@@ -7144,14 +7192,28 @@
component_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- // If `out` is null, we use it for the result, and jump to `done`.
+ // If `out` is null, we use it for the result, and jump to the final label.
__ CompareAndBranchIfZero(out, final_label);
__ LoadFromOffset(kLoadUnsignedHalfword, out, out, primitive_offset);
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ CompareAndBranchIfNonZero(out, &zero);
- __ Bind(&exact_check);
- __ LoadImmediate(out, 1);
- __ b(final_label);
+ __ cmp(out, ShifterOperand(0));
+ // We speculatively set the result to false without changing the condition
+ // flags, which allows us to avoid some branching later.
+ __ mov(out, ShifterOperand(0), AL, kCcKeep);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (ArmAssembler::IsLowRegister(out)) {
+ __ Bind(&exact_check);
+ __ it(EQ);
+ __ mov(out, ShifterOperand(1), EQ);
+ } else {
+ __ b(final_label, NE);
+ __ Bind(&exact_check);
+ __ LoadImmediate(out, 1);
+ }
+
break;
}
@@ -7171,9 +7233,6 @@
codegen_->AddSlowPath(slow_path);
__ b(slow_path->GetEntryLabel(), NE);
__ LoadImmediate(out, 1);
- if (zero.IsLinked()) {
- __ b(final_label);
- }
break;
}
@@ -7202,18 +7261,10 @@
/* is_fatal */ false);
codegen_->AddSlowPath(slow_path);
__ b(slow_path->GetEntryLabel());
- if (zero.IsLinked()) {
- __ b(final_label);
- }
break;
}
}
- if (zero.IsLinked()) {
- __ Bind(&zero);
- __ LoadImmediate(out, 0);
- }
-
if (done.IsLinked()) {
__ Bind(&done);
}
diff --git a/compiler/optimizing/code_generator_arm.h b/compiler/optimizing/code_generator_arm.h
index 59a7f7c..86f2f21 100644
--- a/compiler/optimizing/code_generator_arm.h
+++ b/compiler/optimizing/code_generator_arm.h
@@ -299,7 +299,6 @@
void GenerateCompareTestAndBranch(HCondition* condition,
Label* true_target,
Label* false_target);
- void GenerateFPJumps(HCondition* cond, Label* true_label, Label* false_label);
void GenerateLongComparesAndJumps(HCondition* cond, Label* true_label, Label* false_label);
void DivRemOneOrMinusOne(HBinaryOperation* instruction);
void DivRemByPowerOfTwo(HBinaryOperation* instruction);
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 7257fc5..d463830 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -1150,7 +1150,7 @@
instruction_->IsArrayGet() ||
instruction_->IsInstanceOf() ||
instruction_->IsCheckCast() ||
- (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
<< "Unexpected instruction in read barrier for heap reference slow path: "
<< instruction_->DebugName();
// The read barrier instrumentation of object ArrayGet
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index 2d2d810..cce412b 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -1175,7 +1175,7 @@
instruction_->IsArrayGet() ||
instruction_->IsInstanceOf() ||
instruction_->IsCheckCast() ||
- (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
<< "Unexpected instruction in read barrier for heap reference slow path: "
<< instruction_->DebugName();
// The read barrier instrumentation of object ArrayGet
@@ -1687,14 +1687,21 @@
}
}
-static vixl32::Condition GenerateLongTestConstant(HCondition* condition,
- bool invert,
- CodeGeneratorARMVIXL* codegen) {
+static std::pair<vixl32::Condition, vixl32::Condition> GenerateLongTestConstant(
+ HCondition* condition,
+ bool invert,
+ CodeGeneratorARMVIXL* codegen) {
DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
const LocationSummary* const locations = condition->GetLocations();
- IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
- vixl32::Condition ret = eq;
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+
+ if (invert) {
+ std::swap(cond, opposite);
+ }
+
+ std::pair<vixl32::Condition, vixl32::Condition> ret(eq, ne);
const Location left = locations->InAt(0);
const Location right = locations->InAt(1);
@@ -1713,13 +1720,14 @@
case kCondAE: {
__ Cmp(left_high, High32Bits(value));
+ // We use the scope because of the IT block that follows.
ExactAssemblyScope guard(codegen->GetVIXLAssembler(),
2 * vixl32::k16BitT32InstructionSizeInBytes,
CodeBufferCheckScope::kExactSize);
__ it(eq);
__ cmp(eq, left_low, Low32Bits(value));
- ret = ARMUnsignedCondition(cond);
+ ret = std::make_pair(ARMUnsignedCondition(cond), ARMUnsignedCondition(opposite));
break;
}
case kCondLE:
@@ -1727,15 +1735,19 @@
// Trivially true or false.
if (value == std::numeric_limits<int64_t>::max()) {
__ Cmp(left_low, left_low);
- ret = cond == kCondLE ? eq : ne;
+ ret = cond == kCondLE ? std::make_pair(eq, ne) : std::make_pair(ne, eq);
break;
}
if (cond == kCondLE) {
+ DCHECK_EQ(opposite, kCondGT);
cond = kCondLT;
+ opposite = kCondGE;
} else {
DCHECK_EQ(cond, kCondGT);
+ DCHECK_EQ(opposite, kCondLE);
cond = kCondGE;
+ opposite = kCondLT;
}
value++;
@@ -1746,7 +1758,7 @@
__ Cmp(left_low, Low32Bits(value));
__ Sbcs(temps.Acquire(), left_high, High32Bits(value));
- ret = ARMCondition(cond);
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
break;
}
default:
@@ -1757,14 +1769,21 @@
return ret;
}
-static vixl32::Condition GenerateLongTest(HCondition* condition,
- bool invert,
- CodeGeneratorARMVIXL* codegen) {
+static std::pair<vixl32::Condition, vixl32::Condition> GenerateLongTest(
+ HCondition* condition,
+ bool invert,
+ CodeGeneratorARMVIXL* codegen) {
DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
const LocationSummary* const locations = condition->GetLocations();
- IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
- vixl32::Condition ret = eq;
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+
+ if (invert) {
+ std::swap(cond, opposite);
+ }
+
+ std::pair<vixl32::Condition, vixl32::Condition> ret(eq, ne);
Location left = locations->InAt(0);
Location right = locations->InAt(1);
@@ -1779,22 +1798,27 @@
case kCondAE: {
__ Cmp(HighRegisterFrom(left), HighRegisterFrom(right));
+ // We use the scope because of the IT block that follows.
ExactAssemblyScope guard(codegen->GetVIXLAssembler(),
2 * vixl32::k16BitT32InstructionSizeInBytes,
CodeBufferCheckScope::kExactSize);
__ it(eq);
__ cmp(eq, LowRegisterFrom(left), LowRegisterFrom(right));
- ret = ARMUnsignedCondition(cond);
+ ret = std::make_pair(ARMUnsignedCondition(cond), ARMUnsignedCondition(opposite));
break;
}
case kCondLE:
case kCondGT:
if (cond == kCondLE) {
+ DCHECK_EQ(opposite, kCondGT);
cond = kCondGE;
+ opposite = kCondLT;
} else {
DCHECK_EQ(cond, kCondGT);
+ DCHECK_EQ(opposite, kCondLE);
cond = kCondLT;
+ opposite = kCondGE;
}
std::swap(left, right);
@@ -1805,7 +1829,7 @@
__ Cmp(LowRegisterFrom(left), LowRegisterFrom(right));
__ Sbcs(temps.Acquire(), HighRegisterFrom(left), HighRegisterFrom(right));
- ret = ARMCondition(cond);
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
break;
}
default:
@@ -1816,69 +1840,62 @@
return ret;
}
-static vixl32::Condition GenerateTest(HInstruction* instruction,
- Location loc,
- bool invert,
- CodeGeneratorARMVIXL* codegen) {
- DCHECK(!instruction->IsConstant());
+static std::pair<vixl32::Condition, vixl32::Condition> GenerateTest(HCondition* condition,
+ bool invert,
+ CodeGeneratorARMVIXL* codegen) {
+ const Primitive::Type type = condition->GetLeft()->GetType();
+ IfCondition cond = condition->GetCondition();
+ IfCondition opposite = condition->GetOppositeCondition();
+ std::pair<vixl32::Condition, vixl32::Condition> ret(eq, ne);
- vixl32::Condition ret = invert ? eq : ne;
+ if (invert) {
+ std::swap(cond, opposite);
+ }
- if (IsBooleanValueOrMaterializedCondition(instruction)) {
- __ Cmp(RegisterFrom(loc), 0);
+ if (type == Primitive::kPrimLong) {
+ ret = condition->GetLocations()->InAt(1).IsConstant()
+ ? GenerateLongTestConstant(condition, invert, codegen)
+ : GenerateLongTest(condition, invert, codegen);
+ } else if (Primitive::IsFloatingPointType(type)) {
+ GenerateVcmp(condition, codegen);
+ __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
+ ret = std::make_pair(ARMFPCondition(cond, condition->IsGtBias()),
+ ARMFPCondition(opposite, condition->IsGtBias()));
} else {
- HCondition* const condition = instruction->AsCondition();
- const Primitive::Type type = condition->GetLeft()->GetType();
- const IfCondition cond = invert ? condition->GetOppositeCondition() : condition->GetCondition();
-
- if (type == Primitive::kPrimLong) {
- ret = condition->GetLocations()->InAt(1).IsConstant()
- ? GenerateLongTestConstant(condition, invert, codegen)
- : GenerateLongTest(condition, invert, codegen);
- } else if (Primitive::IsFloatingPointType(type)) {
- GenerateVcmp(condition, codegen);
- __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
- ret = ARMFPCondition(cond, condition->IsGtBias());
- } else {
- DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
- __ Cmp(InputRegisterAt(condition, 0), InputOperandAt(condition, 1));
- ret = ARMCondition(cond);
- }
+ DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+ __ Cmp(InputRegisterAt(condition, 0), InputOperandAt(condition, 1));
+ ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
}
return ret;
}
-static bool CanGenerateTest(HInstruction* condition, ArmVIXLAssembler* assembler) {
- if (!IsBooleanValueOrMaterializedCondition(condition)) {
- const HCondition* const cond = condition->AsCondition();
+static bool CanGenerateTest(HCondition* condition, ArmVIXLAssembler* assembler) {
+ if (condition->GetLeft()->GetType() == Primitive::kPrimLong) {
+ const LocationSummary* const locations = condition->GetLocations();
+ const IfCondition c = condition->GetCondition();
- if (cond->GetLeft()->GetType() == Primitive::kPrimLong) {
- const LocationSummary* const locations = cond->GetLocations();
- const IfCondition c = cond->GetCondition();
+ if (locations->InAt(1).IsConstant()) {
+ const int64_t value = Int64ConstantFrom(locations->InAt(1));
- if (locations->InAt(1).IsConstant()) {
- const int64_t value = Int64ConstantFrom(locations->InAt(1));
-
- if (c < kCondLT || c > kCondGE) {
- // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
- // we check that the least significant half of the first input to be compared
- // is in a low register (the other half is read outside an IT block), and
- // the constant fits in an 8-bit unsigned integer, so that a 16-bit CMP
- // encoding can be used.
- if (!LowRegisterFrom(locations->InAt(0)).IsLow() || !IsUint<8>(Low32Bits(value))) {
- return false;
- }
- // TODO(VIXL): The rest of the checks are there to keep the backend in sync with
- // the previous one, but are not strictly necessary.
- } else if (c == kCondLE || c == kCondGT) {
- if (value < std::numeric_limits<int64_t>::max() &&
- !assembler->ShifterOperandCanHold(SBC, High32Bits(value + 1), kCcSet)) {
- return false;
- }
- } else if (!assembler->ShifterOperandCanHold(SBC, High32Bits(value), kCcSet)) {
+ if (c < kCondLT || c > kCondGE) {
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the least significant half of the first input to be compared
+ // is in a low register (the other half is read outside an IT block), and
+ // the constant fits in an 8-bit unsigned integer, so that a 16-bit CMP
+ // encoding can be used.
+ if (!LowRegisterFrom(locations->InAt(0)).IsLow() || !IsUint<8>(Low32Bits(value))) {
return false;
}
+ // TODO(VIXL): The rest of the checks are there to keep the backend in sync with
+ // the previous one, but are not strictly necessary.
+ } else if (c == kCondLE || c == kCondGT) {
+ if (value < std::numeric_limits<int64_t>::max() &&
+ !assembler->ShifterOperandCanHold(SBC, High32Bits(value + 1), kCcSet)) {
+ return false;
+ }
+ } else if (!assembler->ShifterOperandCanHold(SBC, High32Bits(value), kCcSet)) {
+ return false;
}
}
}
@@ -2445,14 +2462,6 @@
void InstructionCodeGeneratorARMVIXL::VisitExit(HExit* exit ATTRIBUTE_UNUSED) {
}
-void InstructionCodeGeneratorARMVIXL::GenerateFPJumps(HCondition* cond,
- vixl32::Label* true_label,
- vixl32::Label* false_label ATTRIBUTE_UNUSED) {
- // To branch on the result of the FP compare we transfer FPSCR to APSR (encoded as PC in VMRS).
- __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
- __ B(ARMFPCondition(cond->GetCondition(), cond->IsGtBias()), true_label);
-}
-
void InstructionCodeGeneratorARMVIXL::GenerateLongComparesAndJumps(HCondition* cond,
vixl32::Label* true_label,
vixl32::Label* false_label) {
@@ -2469,7 +2478,6 @@
// Set the conditions for the test, remembering that == needs to be
// decided using the low words.
- // TODO: consider avoiding jumps with temporary and CMP low+SBC high
switch (if_cond) {
case kCondEQ:
case kCondNE:
@@ -2540,31 +2548,44 @@
void InstructionCodeGeneratorARMVIXL::GenerateCompareTestAndBranch(HCondition* condition,
vixl32::Label* true_target_in,
vixl32::Label* false_target_in) {
+ if (CanGenerateTest(condition, codegen_->GetAssembler())) {
+ vixl32::Label* non_fallthrough_target;
+ bool invert;
+
+ if (true_target_in == nullptr) {
+ DCHECK(false_target_in != nullptr);
+ non_fallthrough_target = false_target_in;
+ invert = true;
+ } else {
+ non_fallthrough_target = true_target_in;
+ invert = false;
+ }
+
+ const auto cond = GenerateTest(condition, invert, codegen_);
+
+ __ B(cond.first, non_fallthrough_target);
+
+ if (false_target_in != nullptr && false_target_in != non_fallthrough_target) {
+ __ B(false_target_in);
+ }
+
+ return;
+ }
+
// Generated branching requires both targets to be explicit. If either of the
// targets is nullptr (fallthrough) use and bind `fallthrough` instead.
vixl32::Label fallthrough;
vixl32::Label* true_target = (true_target_in == nullptr) ? &fallthrough : true_target_in;
vixl32::Label* false_target = (false_target_in == nullptr) ? &fallthrough : false_target_in;
- Primitive::Type type = condition->InputAt(0)->GetType();
- switch (type) {
- case Primitive::kPrimLong:
- GenerateLongComparesAndJumps(condition, true_target, false_target);
- break;
- case Primitive::kPrimFloat:
- case Primitive::kPrimDouble:
- GenerateVcmp(condition, codegen_);
- GenerateFPJumps(condition, true_target, false_target);
- break;
- default:
- LOG(FATAL) << "Unexpected compare type " << type;
- }
+ DCHECK_EQ(condition->InputAt(0)->GetType(), Primitive::kPrimLong);
+ GenerateLongComparesAndJumps(condition, true_target, false_target);
if (false_target != &fallthrough) {
__ B(false_target);
}
- if (true_target_in == nullptr || false_target_in == nullptr) {
+ if (fallthrough.IsReferenced()) {
__ Bind(&fallthrough);
}
}
@@ -2759,7 +2780,8 @@
}
if (!Primitive::IsFloatingPointType(type) &&
- CanGenerateTest(condition, codegen_->GetAssembler())) {
+ (IsBooleanValueOrMaterializedCondition(condition) ||
+ CanGenerateTest(condition->AsCondition(), codegen_->GetAssembler()))) {
bool invert = false;
if (out.Equals(second)) {
@@ -2783,15 +2805,24 @@
codegen_->MoveLocation(out, src.Equals(first) ? second : first, type);
}
- const vixl32::Condition cond = GenerateTest(condition, locations->InAt(2), invert, codegen_);
+ std::pair<vixl32::Condition, vixl32::Condition> cond(eq, ne);
+
+ if (IsBooleanValueOrMaterializedCondition(condition)) {
+ __ Cmp(InputRegisterAt(select, 2), 0);
+ cond = invert ? std::make_pair(eq, ne) : std::make_pair(ne, eq);
+ } else {
+ cond = GenerateTest(condition->AsCondition(), invert, codegen_);
+ }
+
const size_t instr_count = out.IsRegisterPair() ? 4 : 2;
+ // We use the scope because of the IT block that follows.
ExactAssemblyScope guard(GetVIXLAssembler(),
instr_count * vixl32::k16BitT32InstructionSizeInBytes,
CodeBufferCheckScope::kExactSize);
if (out.IsRegister()) {
- __ it(cond);
- __ mov(cond, RegisterFrom(out), OperandFrom(src, type));
+ __ it(cond.first);
+ __ mov(cond.first, RegisterFrom(out), OperandFrom(src, type));
} else {
DCHECK(out.IsRegisterPair());
@@ -2809,10 +2840,10 @@
operand_low = LowRegisterFrom(src);
}
- __ it(cond);
- __ mov(cond, LowRegisterFrom(out), operand_low);
- __ it(cond);
- __ mov(cond, HighRegisterFrom(out), operand_high);
+ __ it(cond.first);
+ __ mov(cond.first, LowRegisterFrom(out), operand_low);
+ __ it(cond.first);
+ __ mov(cond.first, HighRegisterFrom(out), operand_high);
}
return;
@@ -2865,7 +2896,7 @@
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(cond->InputAt(1)));
if (!cond->IsEmittedAtUseSite()) {
- locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
+ locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
}
break;
@@ -2892,50 +2923,48 @@
return;
}
- Location right = cond->GetLocations()->InAt(1);
- vixl32::Register out = OutputRegister(cond);
- vixl32::Label true_label, false_label;
+ const vixl32::Register out = OutputRegister(cond);
- switch (cond->InputAt(0)->GetType()) {
- default: {
- // Integer case.
- if (right.IsRegister()) {
- __ Cmp(InputRegisterAt(cond, 0), InputOperandAt(cond, 1));
- } else {
- DCHECK(right.IsConstant());
- __ Cmp(InputRegisterAt(cond, 0),
- CodeGenerator::GetInt32ValueOf(right.GetConstant()));
- }
- ExactAssemblyScope aas(GetVIXLAssembler(),
- 3 * vixl32::kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
- __ ite(ARMCondition(cond->GetCondition()));
- __ mov(ARMCondition(cond->GetCondition()), OutputRegister(cond), 1);
- __ mov(ARMCondition(cond->GetOppositeCondition()), OutputRegister(cond), 0);
- return;
- }
- case Primitive::kPrimLong:
- GenerateLongComparesAndJumps(cond, &true_label, &false_label);
- break;
- case Primitive::kPrimFloat:
- case Primitive::kPrimDouble:
- GenerateVcmp(cond, codegen_);
- GenerateFPJumps(cond, &true_label, &false_label);
- break;
+ if (out.IsLow() && CanGenerateTest(cond, codegen_->GetAssembler())) {
+ const auto condition = GenerateTest(cond, false, codegen_);
+ // We use the scope because of the IT block that follows.
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 4 * vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+
+ __ it(condition.first);
+ __ mov(condition.first, out, 1);
+ __ it(condition.second);
+ __ mov(condition.second, out, 0);
+ return;
}
// Convert the jumps into the result.
vixl32::Label done_label;
- vixl32::Label* final_label = codegen_->GetFinalLabel(cond, &done_label);
+ vixl32::Label* const final_label = codegen_->GetFinalLabel(cond, &done_label);
- // False case: result = 0.
- __ Bind(&false_label);
- __ Mov(out, 0);
- __ B(final_label);
+ if (cond->InputAt(0)->GetType() == Primitive::kPrimLong) {
+ vixl32::Label true_label, false_label;
- // True case: result = 1.
- __ Bind(&true_label);
- __ Mov(out, 1);
+ GenerateLongComparesAndJumps(cond, &true_label, &false_label);
+
+ // False case: result = 0.
+ __ Bind(&false_label);
+ __ Mov(out, 0);
+ __ B(final_label);
+
+ // True case: result = 1.
+ __ Bind(&true_label);
+ __ Mov(out, 1);
+ } else {
+ DCHECK(CanGenerateTest(cond, codegen_->GetAssembler()));
+
+ const auto condition = GenerateTest(cond, false, codegen_);
+
+ __ Mov(LeaveFlags, out, 0);
+ __ B(condition.second, final_label, /* far_target */ false);
+ __ Mov(out, 1);
+ }
if (done_label.IsReferenced()) {
__ Bind(&done_label);
@@ -7079,14 +7108,16 @@
uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
uint32_t primitive_offset = mirror::Class::PrimitiveTypeOffset().Int32Value();
- vixl32::Label done, zero;
- vixl32::Label* final_label = codegen_->GetFinalLabel(instruction, &done);
+ vixl32::Label done;
+ vixl32::Label* const final_label = codegen_->GetFinalLabel(instruction, &done);
SlowPathCodeARMVIXL* slow_path = nullptr;
// Return 0 if `obj` is null.
// avoid null check if we know obj is not null.
if (instruction->MustDoNullCheck()) {
- __ CompareAndBranchIfZero(obj, &zero, /* far_target */ false);
+ DCHECK(!out.Is(obj));
+ __ Mov(out, 0);
+ __ CompareAndBranchIfZero(obj, final_label, /* far_target */ false);
}
switch (type_check_kind) {
@@ -7098,11 +7129,28 @@
class_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- __ Cmp(out, cls);
// Classes must be equal for the instanceof to succeed.
- __ B(ne, &zero, /* far_target */ false);
- __ Mov(out, 1);
- __ B(final_label);
+ __ Cmp(out, cls);
+ // We speculatively set the result to false without changing the condition
+ // flags, which allows us to avoid some branching later.
+ __ Mov(LeaveFlags, out, 0);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (out.IsLow()) {
+ // We use the scope because of the IT block that follows.
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+
+ __ it(eq);
+ __ mov(eq, out, 1);
+ } else {
+ __ B(ne, final_label, /* far_target */ false);
+ __ Mov(out, 1);
+ }
+
break;
}
@@ -7124,14 +7172,11 @@
super_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- // If `out` is null, we use it for the result, and jump to `done`.
+ // If `out` is null, we use it for the result, and jump to the final label.
__ CompareAndBranchIfZero(out, final_label, /* far_target */ false);
__ Cmp(out, cls);
__ B(ne, &loop, /* far_target */ false);
__ Mov(out, 1);
- if (zero.IsReferenced()) {
- __ B(final_label);
- }
break;
}
@@ -7154,14 +7199,38 @@
super_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- __ CompareAndBranchIfNonZero(out, &loop);
- // If `out` is null, we use it for the result, and jump to `done`.
- __ B(final_label);
- __ Bind(&success);
- __ Mov(out, 1);
- if (zero.IsReferenced()) {
+ // This is essentially a null check, but it sets the condition flags to the
+ // proper value for the code that follows the loop, i.e. not `eq`.
+ __ Cmp(out, 1);
+ __ B(hs, &loop, /* far_target */ false);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (out.IsLow()) {
+ // If `out` is null, we use it for the result, and the condition flags
+ // have already been set to `ne`, so the IT block that comes afterwards
+ // (and which handles the successful case) turns into a NOP (instead of
+ // overwriting `out`).
+ __ Bind(&success);
+
+ // We use the scope because of the IT block that follows.
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+
+ // There is only one branch to the `success` label (which is bound to this
+ // IT block), and it has the same condition, `eq`, so in that case the MOV
+ // is executed.
+ __ it(eq);
+ __ mov(eq, out, 1);
+ } else {
+ // If `out` is null, we use it for the result, and jump to the final label.
__ B(final_label);
+ __ Bind(&success);
+ __ Mov(out, 1);
}
+
break;
}
@@ -7184,14 +7253,34 @@
component_offset,
maybe_temp_loc,
kCompilerReadBarrierOption);
- // If `out` is null, we use it for the result, and jump to `done`.
+ // If `out` is null, we use it for the result, and jump to the final label.
__ CompareAndBranchIfZero(out, final_label, /* far_target */ false);
GetAssembler()->LoadFromOffset(kLoadUnsignedHalfword, out, out, primitive_offset);
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ CompareAndBranchIfNonZero(out, &zero, /* far_target */ false);
- __ Bind(&exact_check);
- __ Mov(out, 1);
- __ B(final_label);
+ __ Cmp(out, 0);
+ // We speculatively set the result to false without changing the condition
+ // flags, which allows us to avoid some branching later.
+ __ Mov(LeaveFlags, out, 0);
+
+ // Since IT blocks longer than a 16-bit instruction are deprecated by ARMv8,
+ // we check that the output is in a low register, so that a 16-bit MOV
+ // encoding can be used.
+ if (out.IsLow()) {
+ __ Bind(&exact_check);
+
+ // We use the scope because of the IT block that follows.
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+
+ __ it(eq);
+ __ mov(eq, out, 1);
+ } else {
+ __ B(ne, final_label, /* far_target */ false);
+ __ Bind(&exact_check);
+ __ Mov(out, 1);
+ }
+
break;
}
@@ -7211,9 +7300,6 @@
codegen_->AddSlowPath(slow_path);
__ B(ne, slow_path->GetEntryLabel());
__ Mov(out, 1);
- if (zero.IsReferenced()) {
- __ B(final_label);
- }
break;
}
@@ -7242,18 +7328,10 @@
/* is_fatal */ false);
codegen_->AddSlowPath(slow_path);
__ B(slow_path->GetEntryLabel());
- if (zero.IsReferenced()) {
- __ B(final_label);
- }
break;
}
}
- if (zero.IsReferenced()) {
- __ Bind(&zero);
- __ Mov(out, 0);
- }
-
if (done.IsReferenced()) {
__ Bind(&done);
}
diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h
index 781027a..1e9669d 100644
--- a/compiler/optimizing/code_generator_arm_vixl.h
+++ b/compiler/optimizing/code_generator_arm_vixl.h
@@ -401,9 +401,6 @@
void GenerateCompareTestAndBranch(HCondition* condition,
vixl::aarch32::Label* true_target,
vixl::aarch32::Label* false_target);
- void GenerateFPJumps(HCondition* cond,
- vixl::aarch32::Label* true_label,
- vixl::aarch32::Label* false_label);
void GenerateLongComparesAndJumps(HCondition* cond,
vixl::aarch32::Label* true_label,
vixl::aarch32::Label* false_label);
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 5246dbc..c82533b 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -558,26 +558,21 @@
return;
}
- // Make sure the frame size isn't unreasonably large. Per the various APIs
- // it looks like it should always be less than 2GB in size, which allows
- // us using 32-bit signed offsets from the stack pointer.
- if (GetFrameSize() > 0x7FFFFFFF)
- LOG(FATAL) << "Stack frame larger than 2GB";
+ // Make sure the frame size isn't unreasonably large.
+ if (GetFrameSize() > GetStackOverflowReservedBytes(kMips64)) {
+ LOG(FATAL) << "Stack frame larger than " << GetStackOverflowReservedBytes(kMips64) << " bytes";
+ }
// Spill callee-saved registers.
- // Note that their cumulative size is small and they can be indexed using
- // 16-bit offsets.
- // TODO: increment/decrement SP in one step instead of two or remove this comment.
-
- uint32_t ofs = FrameEntrySpillSize();
+ uint32_t ofs = GetFrameSize();
__ IncreaseFrameSize(ofs);
for (int i = arraysize(kCoreCalleeSaves) - 1; i >= 0; --i) {
GpuRegister reg = kCoreCalleeSaves[i];
if (allocated_registers_.ContainsCoreRegister(reg)) {
ofs -= kMips64DoublewordSize;
- __ Sd(reg, SP, ofs);
+ __ StoreToOffset(kStoreDoubleword, reg, SP, ofs);
__ cfi().RelOffset(DWARFReg(reg), ofs);
}
}
@@ -586,23 +581,16 @@
FpuRegister reg = kFpuCalleeSaves[i];
if (allocated_registers_.ContainsFloatingPointRegister(reg)) {
ofs -= kMips64DoublewordSize;
- __ Sdc1(reg, SP, ofs);
+ __ StoreFpuToOffset(kStoreDoubleword, reg, SP, ofs);
__ cfi().RelOffset(DWARFReg(reg), ofs);
}
}
- // Allocate the rest of the frame and store the current method pointer
- // at its end.
-
- __ IncreaseFrameSize(GetFrameSize() - FrameEntrySpillSize());
-
// Save the current method if we need it. Note that we do not
// do this in HCurrentMethod, as the instruction might have been removed
// in the SSA graph.
if (RequiresCurrentMethod()) {
- static_assert(IsInt<16>(kCurrentMethodStackOffset),
- "kCurrentMethodStackOffset must fit into int16_t");
- __ Sd(kMethodRegisterArgument, SP, kCurrentMethodStackOffset);
+ __ StoreToOffset(kStoreDoubleword, kMethodRegisterArgument, SP, kCurrentMethodStackOffset);
}
if (GetGraph()->HasShouldDeoptimizeFlag()) {
@@ -615,42 +603,32 @@
__ cfi().RememberState();
if (!HasEmptyFrame()) {
- // Deallocate the rest of the frame.
-
- __ DecreaseFrameSize(GetFrameSize() - FrameEntrySpillSize());
-
// Restore callee-saved registers.
- // Note that their cumulative size is small and they can be indexed using
- // 16-bit offsets.
- // TODO: increment/decrement SP in one step instead of two or remove this comment.
-
- uint32_t ofs = 0;
-
- for (size_t i = 0; i < arraysize(kFpuCalleeSaves); ++i) {
- FpuRegister reg = kFpuCalleeSaves[i];
- if (allocated_registers_.ContainsFloatingPointRegister(reg)) {
- __ Ldc1(reg, SP, ofs);
- ofs += kMips64DoublewordSize;
- __ cfi().Restore(DWARFReg(reg));
- }
- }
-
- for (size_t i = 0; i < arraysize(kCoreCalleeSaves); ++i) {
+ // For better instruction scheduling restore RA before other registers.
+ uint32_t ofs = GetFrameSize();
+ for (int i = arraysize(kCoreCalleeSaves) - 1; i >= 0; --i) {
GpuRegister reg = kCoreCalleeSaves[i];
if (allocated_registers_.ContainsCoreRegister(reg)) {
- __ Ld(reg, SP, ofs);
- ofs += kMips64DoublewordSize;
+ ofs -= kMips64DoublewordSize;
+ __ LoadFromOffset(kLoadDoubleword, reg, SP, ofs);
__ cfi().Restore(DWARFReg(reg));
}
}
- DCHECK_EQ(ofs, FrameEntrySpillSize());
- __ DecreaseFrameSize(ofs);
+ for (int i = arraysize(kFpuCalleeSaves) - 1; i >= 0; --i) {
+ FpuRegister reg = kFpuCalleeSaves[i];
+ if (allocated_registers_.ContainsFloatingPointRegister(reg)) {
+ ofs -= kMips64DoublewordSize;
+ __ LoadFpuFromOffset(kLoadDoubleword, reg, SP, ofs);
+ __ cfi().Restore(DWARFReg(reg));
+ }
+ }
+
+ __ DecreaseFrameSize(GetFrameSize());
}
- __ Jr(RA);
- __ Nop();
+ __ Jic(RA, 0);
__ cfi().RestoreState();
__ cfi().DefCFAOffset(GetFrameSize());
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index 4db4796..80776e8 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -723,7 +723,7 @@
instruction_->IsArrayGet() ||
instruction_->IsInstanceOf() ||
instruction_->IsCheckCast() ||
- (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
<< "Unexpected instruction in read barrier for heap reference slow path: "
<< instruction_->DebugName();
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 3f321ba..49f099f 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -744,7 +744,7 @@
instruction_->IsArrayGet() ||
instruction_->IsInstanceOf() ||
instruction_->IsCheckCast() ||
- (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
<< "Unexpected instruction in read barrier for heap reference slow path: "
<< instruction_->DebugName();
diff --git a/compiler/optimizing/codegen_test_utils.h b/compiler/optimizing/codegen_test_utils.h
index cd95404..31cd204 100644
--- a/compiler/optimizing/codegen_test_utils.h
+++ b/compiler/optimizing/codegen_test_utils.h
@@ -74,7 +74,6 @@
}
private:
- CodegenTargetConfig() {}
InstructionSet isa_;
CreateCodegenFn create_codegen_;
};
diff --git a/compiler/optimizing/common_arm.h b/compiler/optimizing/common_arm.h
index e184745..01304ac 100644
--- a/compiler/optimizing/common_arm.h
+++ b/compiler/optimizing/common_arm.h
@@ -66,6 +66,11 @@
return vixl::aarch32::SRegister(location.AsFpuRegisterPairLow<vixl::aarch32::SRegister>());
}
+inline vixl::aarch32::SRegister HighSRegisterFrom(Location location) {
+ DCHECK(location.IsFpuRegisterPair()) << location;
+ return vixl::aarch32::SRegister(location.AsFpuRegisterPairHigh<vixl::aarch32::SRegister>());
+}
+
inline vixl::aarch32::Register RegisterFrom(Location location) {
DCHECK(location.IsRegister()) << location;
return vixl::aarch32::Register(location.reg());
diff --git a/compiler/optimizing/graph_visualizer.cc b/compiler/optimizing/graph_visualizer.cc
index 0dfae11..cc3c143 100644
--- a/compiler/optimizing/graph_visualizer.cc
+++ b/compiler/optimizing/graph_visualizer.cc
@@ -505,6 +505,10 @@
StartAttributeStream("kind") << (try_boundary->IsEntry() ? "entry" : "exit");
}
+ void VisitDeoptimize(HDeoptimize* deoptimize) OVERRIDE {
+ StartAttributeStream("kind") << deoptimize->GetKind();
+ }
+
#if defined(ART_ENABLE_CODEGEN_arm) || defined(ART_ENABLE_CODEGEN_arm64)
void VisitMultiplyAccumulate(HMultiplyAccumulate* instruction) OVERRIDE {
StartAttributeStream("kind") << instruction->GetOpKind();
diff --git a/compiler/optimizing/induction_var_analysis_test.cc b/compiler/optimizing/induction_var_analysis_test.cc
index 82ee93d..9516ccb 100644
--- a/compiler/optimizing/induction_var_analysis_test.cc
+++ b/compiler/optimizing/induction_var_analysis_test.cc
@@ -29,7 +29,21 @@
*/
class InductionVarAnalysisTest : public CommonCompilerTest {
public:
- InductionVarAnalysisTest() : pool_(), allocator_(&pool_) {
+ InductionVarAnalysisTest()
+ : pool_(),
+ allocator_(&pool_),
+ iva_(nullptr),
+ entry_(nullptr),
+ return_(nullptr),
+ exit_(nullptr),
+ parameter_(nullptr),
+ constant0_(nullptr),
+ constant1_(nullptr),
+ constant2_(nullptr),
+ constant7_(nullptr),
+ constant100_(nullptr),
+ constantm1_(nullptr),
+ float_constant0_(nullptr) {
graph_ = CreateGraph(&allocator_);
}
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index 62f5114..19f668d 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -46,32 +46,100 @@
namespace art {
-static constexpr size_t kMaximumNumberOfHInstructions = 32;
+// Instruction limit to control memory.
+static constexpr size_t kMaximumNumberOfTotalInstructions = 1024;
+
+// Maximum number of instructions for considering a method small,
+// which we will always try to inline if the other non-instruction limits
+// are not reached.
+static constexpr size_t kMaximumNumberOfInstructionsForSmallMethod = 3;
// Limit the number of dex registers that we accumulate while inlining
// to avoid creating large amount of nested environments.
static constexpr size_t kMaximumNumberOfCumulatedDexRegisters = 64;
-// Avoid inlining within a huge method due to memory pressure.
-static constexpr size_t kMaximumCodeUnitSize = 4096;
+// Limit recursive call inlining, which do not benefit from too
+// much inlining compared to code locality.
+static constexpr size_t kMaximumNumberOfRecursiveCalls = 4;
// Controls the use of inline caches in AOT mode.
static constexpr bool kUseAOTInlineCaches = false;
+// We check for line numbers to make sure the DepthString implementation
+// aligns the output nicely.
+#define LOG_INTERNAL(msg) \
+ static_assert(__LINE__ > 10, "Unhandled line number"); \
+ static_assert(__LINE__ < 10000, "Unhandled line number"); \
+ VLOG(compiler) << DepthString(__LINE__) << msg
+
+#define LOG_TRY() LOG_INTERNAL("Try inlinining call: ")
+#define LOG_NOTE() LOG_INTERNAL("Note: ")
+#define LOG_SUCCESS() LOG_INTERNAL("Success: ")
+#define LOG_FAIL(stat) MaybeRecordStat(stat); LOG_INTERNAL("Fail: ")
+#define LOG_FAIL_NO_STAT() LOG_INTERNAL("Fail: ")
+
+std::string HInliner::DepthString(int line) const {
+ std::string value;
+ // Indent according to the inlining depth.
+ size_t count = depth_;
+ // Line numbers get printed in the log, so add a space if the log's line is less
+ // than 1000, and two if less than 100. 10 cannot be reached as it's the copyright.
+ if (!kIsTargetBuild) {
+ if (line < 100) {
+ value += " ";
+ }
+ if (line < 1000) {
+ value += " ";
+ }
+ // Safeguard if this file reaches more than 10000 lines.
+ DCHECK_LT(line, 10000);
+ }
+ for (size_t i = 0; i < count; ++i) {
+ value += " ";
+ }
+ return value;
+}
+
+static size_t CountNumberOfInstructions(HGraph* graph) {
+ size_t number_of_instructions = 0;
+ for (HBasicBlock* block : graph->GetReversePostOrderSkipEntryBlock()) {
+ for (HInstructionIterator instr_it(block->GetInstructions());
+ !instr_it.Done();
+ instr_it.Advance()) {
+ ++number_of_instructions;
+ }
+ }
+ return number_of_instructions;
+}
+
+void HInliner::UpdateInliningBudget() {
+ if (total_number_of_instructions_ >= kMaximumNumberOfTotalInstructions) {
+ // Always try to inline small methods.
+ inlining_budget_ = kMaximumNumberOfInstructionsForSmallMethod;
+ } else {
+ inlining_budget_ = std::max(
+ kMaximumNumberOfInstructionsForSmallMethod,
+ kMaximumNumberOfTotalInstructions - total_number_of_instructions_);
+ }
+}
+
void HInliner::Run() {
- const CompilerOptions& compiler_options = compiler_driver_->GetCompilerOptions();
- if ((compiler_options.GetInlineDepthLimit() == 0)
- || (compiler_options.GetInlineMaxCodeUnits() == 0)) {
- return;
- }
- if (caller_compilation_unit_.GetCodeItem()->insns_size_in_code_units_ > kMaximumCodeUnitSize) {
- return;
- }
if (graph_->IsDebuggable()) {
// For simplicity, we currently never inline when the graph is debuggable. This avoids
// doing some logic in the runtime to discover if a method could have been inlined.
return;
}
+
+ // Initialize the number of instructions for the method being compiled. Recursive calls
+ // to HInliner::Run have already updated the instruction count.
+ if (outermost_graph_ == graph_) {
+ total_number_of_instructions_ = CountNumberOfInstructions(graph_);
+ }
+
+ UpdateInliningBudget();
+ DCHECK_NE(total_number_of_instructions_, 0u);
+ DCHECK_NE(inlining_budget_, 0u);
+
// Keep a copy of all blocks when starting the visit.
ArenaVector<HBasicBlock*> blocks = graph_->GetReversePostOrder();
DCHECK(!blocks.empty());
@@ -292,7 +360,18 @@
return nullptr;
}
PointerSize pointer_size = caller_compilation_unit_.GetClassLinker()->GetImagePointerSize();
- return resolved_method->GetSingleImplementation(pointer_size);
+ ArtMethod* single_impl = resolved_method->GetSingleImplementation(pointer_size);
+ if (single_impl == nullptr) {
+ return nullptr;
+ }
+ if (single_impl->IsProxyMethod()) {
+ // Proxy method is a generic invoker that's not worth
+ // devirtualizing/inlining. It also causes issues when the proxy
+ // method is in another dex file if we try to rewrite invoke-interface to
+ // invoke-virtual because a proxy method doesn't have a real dex file.
+ return nullptr;
+ }
+ return single_impl;
}
bool HInliner::TryInline(HInvoke* invoke_instruction) {
@@ -305,17 +384,18 @@
ScopedObjectAccess soa(Thread::Current());
uint32_t method_index = invoke_instruction->GetDexMethodIndex();
const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
- VLOG(compiler) << "Try inlining " << caller_dex_file.PrettyMethod(method_index);
+ LOG_TRY() << caller_dex_file.PrettyMethod(method_index);
- // We can query the dex cache directly. The verifier has populated it already.
ArtMethod* resolved_method = invoke_instruction->GetResolvedMethod();
- ArtMethod* actual_method = nullptr;
if (resolved_method == nullptr) {
DCHECK(invoke_instruction->IsInvokeStaticOrDirect());
DCHECK(invoke_instruction->AsInvokeStaticOrDirect()->IsStringInit());
- VLOG(compiler) << "Not inlining a String.<init> method";
+ LOG_FAIL_NO_STAT() << "Not inlining a String.<init> method";
return false;
- } else if (invoke_instruction->IsInvokeStaticOrDirect()) {
+ }
+ ArtMethod* actual_method = nullptr;
+
+ if (invoke_instruction->IsInvokeStaticOrDirect()) {
actual_method = resolved_method;
} else {
// Check if we can statically find the method.
@@ -328,6 +408,7 @@
if (method != nullptr) {
cha_devirtualize = true;
actual_method = method;
+ LOG_NOTE() << "Try CHA-based inlining of " << actual_method->PrettyMethod();
}
}
@@ -390,16 +471,23 @@
: GetInlineCacheJIT(invoke_instruction, &hs, &inline_cache);
switch (inline_cache_type) {
- case kInlineCacheNoData:
- break;
-
- case kInlineCacheUninitialized:
- VLOG(compiler) << "Interface or virtual call to "
- << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
- << " is not hit and not inlined";
+ case kInlineCacheNoData: {
+ LOG_FAIL_NO_STAT()
+ << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
+ << " could not be statically determined";
return false;
+ }
- case kInlineCacheMonomorphic:
+ case kInlineCacheUninitialized: {
+ LOG_FAIL_NO_STAT()
+ << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
+ << " is not hit and not inlined";
+ return false;
+ }
+
+ case kInlineCacheMonomorphic: {
MaybeRecordStat(kMonomorphicCall);
if (outermost_graph_->IsCompilingOsr()) {
// If we are compiling OSR, we pretend this call is polymorphic, as we may come from the
@@ -408,23 +496,29 @@
} else {
return TryInlineMonomorphicCall(invoke_instruction, resolved_method, inline_cache);
}
+ }
- case kInlineCachePolymorphic:
+ case kInlineCachePolymorphic: {
MaybeRecordStat(kPolymorphicCall);
return TryInlinePolymorphicCall(invoke_instruction, resolved_method, inline_cache);
+ }
- case kInlineCacheMegamorphic:
- VLOG(compiler) << "Interface or virtual call to "
- << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
- << " is megamorphic and not inlined";
+ case kInlineCacheMegamorphic: {
+ LOG_FAIL_NO_STAT()
+ << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
+ << " is megamorphic and not inlined";
MaybeRecordStat(kMegamorphicCall);
return false;
+ }
- case kInlineCacheMissingTypes:
- VLOG(compiler) << "Interface or virtual call to "
- << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
- << " is missing types and not inlined";
+ case kInlineCacheMissingTypes: {
+ LOG_FAIL_NO_STAT()
+ << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(invoke_instruction->GetDexMethodIndex())
+ << " is missing types and not inlined";
return false;
+ }
}
UNREACHABLE();
}
@@ -587,9 +681,10 @@
dex::TypeIndex class_index = FindClassIndexIn(
GetMonomorphicType(classes), caller_compilation_unit_);
if (!class_index.IsValid()) {
- VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
- << " from inline cache is not inlined because its class is not"
- << " accessible to the caller";
+ LOG_FAIL(kNotInlinedDexCache)
+ << "Call to " << ArtMethod::PrettyMethod(resolved_method)
+ << " from inline cache is not inlined because its class is not"
+ << " accessible to the caller";
return false;
}
@@ -603,6 +698,7 @@
resolved_method = GetMonomorphicType(classes)->FindVirtualMethodForVirtual(
resolved_method, pointer_size);
}
+ LOG_NOTE() << "Try inline monomorphic call to " << resolved_method->PrettyMethod();
DCHECK(resolved_method != nullptr);
HInstruction* receiver = invoke_instruction->InputAt(0);
HInstruction* cursor = invoke_instruction->GetPrevious();
@@ -646,7 +742,8 @@
HShouldDeoptimizeFlag(graph_->GetArena(), dex_pc);
HInstruction* compare = new (graph_->GetArena()) HNotEqual(
deopt_flag, graph_->GetIntConstant(0, dex_pc));
- HInstruction* deopt = new (graph_->GetArena()) HDeoptimize(compare, dex_pc);
+ HInstruction* deopt = new (graph_->GetArena()) HDeoptimize(
+ graph_->GetArena(), compare, HDeoptimize::Kind::kInline, dex_pc);
if (cursor != nullptr) {
bb_cursor->InsertInstructionAfter(deopt_flag, cursor);
@@ -710,9 +807,16 @@
bb_cursor->InsertInstructionAfter(compare, load_class);
if (with_deoptimization) {
HDeoptimize* deoptimize = new (graph_->GetArena()) HDeoptimize(
- compare, invoke_instruction->GetDexPc());
+ graph_->GetArena(),
+ compare,
+ receiver,
+ HDeoptimize::Kind::kInline,
+ invoke_instruction->GetDexPc());
bb_cursor->InsertInstructionAfter(deoptimize, compare);
deoptimize->CopyEnvironmentFrom(invoke_instruction->GetEnvironment());
+ DCHECK_EQ(invoke_instruction->InputAt(0), receiver);
+ receiver->ReplaceUsesDominatedBy(deoptimize, deoptimize);
+ deoptimize->SetReferenceTypeInfo(receiver->GetReferenceTypeInfo());
}
return compare;
}
@@ -752,6 +856,7 @@
dex::TypeIndex class_index = FindClassIndexIn(handle.Get(), caller_compilation_unit_);
HInstruction* return_replacement = nullptr;
+ LOG_NOTE() << "Try inline polymorphic call to " << method->PrettyMethod();
if (!class_index.IsValid() ||
!TryBuildAndInline(invoke_instruction,
method,
@@ -761,8 +866,8 @@
} else {
one_target_inlined = true;
- VLOG(compiler) << "Polymorphic call to " << ArtMethod::PrettyMethod(resolved_method)
- << " has inlined " << ArtMethod::PrettyMethod(method);
+ LOG_SUCCESS() << "Polymorphic call to " << ArtMethod::PrettyMethod(resolved_method)
+ << " has inlined " << ArtMethod::PrettyMethod(method);
// If we have inlined all targets before, and this receiver is the last seen,
// we deoptimize instead of keeping the original invoke instruction.
@@ -796,9 +901,10 @@
}
if (!one_target_inlined) {
- VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
- << " from inline cache is not inlined because none"
- << " of its targets could be inlined";
+ LOG_FAIL_NO_STAT()
+ << "Call to " << ArtMethod::PrettyMethod(resolved_method)
+ << " from inline cache is not inlined because none"
+ << " of its targets could be inlined";
return false;
}
@@ -932,9 +1038,6 @@
actual_method = new_method;
} else if (actual_method != new_method) {
// Different methods, bailout.
- VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
- << " from inline cache is not inlined because it resolves"
- << " to different methods";
return false;
}
}
@@ -988,13 +1091,19 @@
CreateDiamondPatternForPolymorphicInline(compare, return_replacement, invoke_instruction);
} else {
HDeoptimize* deoptimize = new (graph_->GetArena()) HDeoptimize(
- compare, invoke_instruction->GetDexPc());
+ graph_->GetArena(),
+ compare,
+ receiver,
+ HDeoptimize::Kind::kInline,
+ invoke_instruction->GetDexPc());
bb_cursor->InsertInstructionAfter(deoptimize, compare);
deoptimize->CopyEnvironmentFrom(invoke_instruction->GetEnvironment());
if (return_replacement != nullptr) {
invoke_instruction->ReplaceWith(return_replacement);
}
+ receiver->ReplaceUsesDominatedBy(deoptimize, deoptimize);
invoke_instruction->GetBlock()->RemoveInstruction(invoke_instruction);
+ deoptimize->SetReferenceTypeInfo(receiver->GetReferenceTypeInfo());
}
// Run type propagation to get the guard typed.
@@ -1007,6 +1116,7 @@
MaybeRecordStat(kInlinedPolymorphicCall);
+ LOG_SUCCESS() << "Inlined same polymorphic target " << actual_method->PrettyMethod();
return true;
}
@@ -1021,11 +1131,23 @@
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
if (!TryBuildAndInline(invoke_instruction, method, receiver_type, &return_replacement)) {
if (invoke_instruction->IsInvokeInterface()) {
+ DCHECK(!method->IsProxyMethod());
// Turn an invoke-interface into an invoke-virtual. An invoke-virtual is always
// better than an invoke-interface because:
// 1) In the best case, the interface call has one more indirection (to fetch the IMT).
// 2) We will not go to the conflict trampoline with an invoke-virtual.
// TODO: Consider sharpening once it is not dependent on the compiler driver.
+
+ if (method->IsDefault() && !method->IsCopied()) {
+ // Changing to invoke-virtual cannot be done on an original default method
+ // since it's not in any vtable. Devirtualization by exact type/inline-cache
+ // always uses a method in the iftable which is never an original default
+ // method.
+ // On the other hand, inlining an original default method by CHA is fine.
+ DCHECK(cha_devirtualize);
+ return false;
+ }
+
const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
uint32_t dex_method_index = FindMethodIndexIn(
method, caller_dex_file, invoke_instruction->GetDexMethodIndex());
@@ -1076,13 +1198,34 @@
return true;
}
+size_t HInliner::CountRecursiveCallsOf(ArtMethod* method) const {
+ const HInliner* current = this;
+ size_t count = 0;
+ do {
+ if (current->graph_->GetArtMethod() == method) {
+ ++count;
+ }
+ current = current->parent_;
+ } while (current != nullptr);
+ return count;
+}
+
bool HInliner::TryBuildAndInline(HInvoke* invoke_instruction,
ArtMethod* method,
ReferenceTypeInfo receiver_type,
HInstruction** return_replacement) {
if (method->IsProxyMethod()) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " is not inlined because of unimplemented inline support for proxy methods.";
+ LOG_FAIL(kNotInlinedProxy)
+ << "Method " << method->PrettyMethod()
+ << " is not inlined because of unimplemented inline support for proxy methods.";
+ return false;
+ }
+
+ if (CountRecursiveCallsOf(method) > kMaximumNumberOfRecursiveCalls) {
+ LOG_FAIL(kNotInlinedRecursiveBudget)
+ << "Method "
+ << method->PrettyMethod()
+ << " is not inlined because it has reached its recursive call budget.";
return false;
}
@@ -1091,15 +1234,16 @@
if (!compiler_driver_->MayInline(method->GetDexFile(),
outer_compilation_unit_.GetDexFile())) {
if (TryPatternSubstitution(invoke_instruction, method, return_replacement)) {
- VLOG(compiler) << "Successfully replaced pattern of invoke "
- << method->PrettyMethod();
+ LOG_SUCCESS() << "Successfully replaced pattern of invoke "
+ << method->PrettyMethod();
MaybeRecordStat(kReplacedInvokeWithSimplePattern);
return true;
}
- VLOG(compiler) << "Won't inline " << method->PrettyMethod() << " in "
- << outer_compilation_unit_.GetDexFile()->GetLocation() << " ("
- << caller_compilation_unit_.GetDexFile()->GetLocation() << ") from "
- << method->GetDexFile()->GetLocation();
+ LOG_FAIL(kNotInlinedWont)
+ << "Won't inline " << method->PrettyMethod() << " in "
+ << outer_compilation_unit_.GetDexFile()->GetLocation() << " ("
+ << caller_compilation_unit_.GetDexFile()->GetLocation() << ") from "
+ << method->GetDexFile()->GetLocation();
return false;
}
@@ -1108,30 +1252,32 @@
const DexFile::CodeItem* code_item = method->GetCodeItem();
if (code_item == nullptr) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " is not inlined because it is native";
+ LOG_FAIL_NO_STAT()
+ << "Method " << method->PrettyMethod() << " is not inlined because it is native";
return false;
}
size_t inline_max_code_units = compiler_driver_->GetCompilerOptions().GetInlineMaxCodeUnits();
if (code_item->insns_size_in_code_units_ > inline_max_code_units) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " is too big to inline: "
- << code_item->insns_size_in_code_units_
- << " > "
- << inline_max_code_units;
+ LOG_FAIL(kNotInlinedCodeItem)
+ << "Method " << method->PrettyMethod()
+ << " is not inlined because its code item is too big: "
+ << code_item->insns_size_in_code_units_
+ << " > "
+ << inline_max_code_units;
return false;
}
if (code_item->tries_size_ != 0) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " is not inlined because of try block";
+ LOG_FAIL(kNotInlinedTryCatch)
+ << "Method " << method->PrettyMethod() << " is not inlined because of try block";
return false;
}
if (!method->IsCompilable()) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " has soft failures un-handled by the compiler, so it cannot be inlined";
+ LOG_FAIL(kNotInlinedNotVerified)
+ << "Method " << method->PrettyMethod()
+ << " has soft failures un-handled by the compiler, so it cannot be inlined";
}
if (!method->GetDeclaringClass()->IsVerified()) {
@@ -1139,8 +1285,9 @@
if (Runtime::Current()->UseJitCompilation() ||
!compiler_driver_->IsMethodVerifiedWithoutFailures(
method->GetDexMethodIndex(), class_def_idx, *method->GetDexFile())) {
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " couldn't be verified, so it cannot be inlined";
+ LOG_FAIL(kNotInlinedNotVerified)
+ << "Method " << method->PrettyMethod()
+ << " couldn't be verified, so it cannot be inlined";
return false;
}
}
@@ -1149,9 +1296,9 @@
invoke_instruction->AsInvokeStaticOrDirect()->IsStaticWithImplicitClinitCheck()) {
// Case of a static method that cannot be inlined because it implicitly
// requires an initialization check of its declaring class.
- VLOG(compiler) << "Method " << method->PrettyMethod()
- << " is not inlined because it is static and requires a clinit"
- << " check that cannot be emitted due to Dex cache limitations";
+ LOG_FAIL(kNotInlinedDexCache) << "Method " << method->PrettyMethod()
+ << " is not inlined because it is static and requires a clinit"
+ << " check that cannot be emitted due to Dex cache limitations";
return false;
}
@@ -1160,7 +1307,7 @@
return false;
}
- VLOG(compiler) << "Successfully inlined " << method->PrettyMethod();
+ LOG_SUCCESS() << method->PrettyMethod();
MaybeRecordStat(kInlinedInvoke);
return true;
}
@@ -1448,15 +1595,17 @@
handles_);
if (builder.BuildGraph() != kAnalysisSuccess) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be built, so cannot be inlined";
+ LOG_FAIL(kNotInlinedCannotBuild)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be built, so cannot be inlined";
return false;
}
if (!RegisterAllocator::CanAllocateRegistersFor(*callee_graph,
compiler_driver_->GetInstructionSet())) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " cannot be inlined because of the register allocator";
+ LOG_FAIL(kNotInlinedRegisterAllocator)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " cannot be inlined because of the register allocator";
return false;
}
@@ -1503,15 +1652,13 @@
/* is_first_run */ false).Run();
}
- size_t number_of_instructions_budget = kMaximumNumberOfHInstructions;
- size_t number_of_inlined_instructions =
- RunOptimizations(callee_graph, code_item, dex_compilation_unit);
- number_of_instructions_budget += number_of_inlined_instructions;
+ RunOptimizations(callee_graph, code_item, dex_compilation_unit);
HBasicBlock* exit_block = callee_graph->GetExitBlock();
if (exit_block == nullptr) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it has an infinite loop";
+ LOG_FAIL(kNotInlinedInfiniteLoop)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because it has an infinite loop";
return false;
}
@@ -1520,15 +1667,17 @@
if (predecessor->GetLastInstruction()->IsThrow()) {
if (invoke_instruction->GetBlock()->IsTryBlock()) {
// TODO(ngeoffray): Support adding HTryBoundary in Hgraph::InlineInto.
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because one branch always throws and"
- << " caller is in a try/catch block";
+ LOG_FAIL(kNotInlinedTryCatch)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because one branch always throws and"
+ << " caller is in a try/catch block";
return false;
} else if (graph_->GetExitBlock() == nullptr) {
// TODO(ngeoffray): Support adding HExit in the caller graph.
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because one branch always throws and"
- << " caller does not have an exit block";
+ LOG_FAIL(kNotInlinedInfiniteLoop)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because one branch always throws and"
+ << " caller does not have an exit block";
return false;
} else if (graph_->HasIrreducibleLoops()) {
// TODO(ngeoffray): Support re-computing loop information to graphs with
@@ -1544,32 +1693,31 @@
}
if (!has_one_return) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it always throws";
+ LOG_FAIL(kNotInlinedAlwaysThrows)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because it always throws";
return false;
}
size_t number_of_instructions = 0;
-
- bool can_inline_environment =
- total_number_of_dex_registers_ < kMaximumNumberOfCumulatedDexRegisters;
-
// Skip the entry block, it does not contain instructions that prevent inlining.
for (HBasicBlock* block : callee_graph->GetReversePostOrderSkipEntryBlock()) {
if (block->IsLoopHeader()) {
if (block->GetLoopInformation()->IsIrreducible()) {
// Don't inline methods with irreducible loops, they could prevent some
// optimizations to run.
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it contains an irreducible loop";
+ LOG_FAIL(kNotInlinedIrreducibleLoop)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because it contains an irreducible loop";
return false;
}
if (!block->GetLoopInformation()->HasExitEdge()) {
// Don't inline methods with loops without exit, since they cause the
// loop information to be computed incorrectly when updating after
// inlining.
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it contains a loop with no exit";
+ LOG_FAIL(kNotInlinedLoopWithoutExit)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because it contains a loop with no exit";
return false;
}
}
@@ -1577,34 +1725,39 @@
for (HInstructionIterator instr_it(block->GetInstructions());
!instr_it.Done();
instr_it.Advance()) {
- if (number_of_instructions++ == number_of_instructions_budget) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " is not inlined because its caller has reached"
- << " its instruction budget limit.";
+ if (++number_of_instructions >= inlining_budget_) {
+ LOG_FAIL(kNotInlinedInstructionBudget)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " is not inlined because the outer method has reached"
+ << " its instruction budget limit.";
return false;
}
HInstruction* current = instr_it.Current();
- if (!can_inline_environment && current->NeedsEnvironment()) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " is not inlined because its caller has reached"
- << " its environment budget limit.";
+ if (current->NeedsEnvironment() &&
+ (total_number_of_dex_registers_ >= kMaximumNumberOfCumulatedDexRegisters)) {
+ LOG_FAIL(kNotInlinedEnvironmentBudget)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " is not inlined because its caller has reached"
+ << " its environment budget limit.";
return false;
}
if (current->NeedsEnvironment() &&
!CanEncodeInlinedMethodInStackMap(*caller_compilation_unit_.GetDexFile(),
resolved_method)) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because " << current->DebugName()
- << " needs an environment, is in a different dex file"
- << ", and cannot be encoded in the stack maps.";
+ LOG_FAIL(kNotInlinedStackMaps)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because " << current->DebugName()
+ << " needs an environment, is in a different dex file"
+ << ", and cannot be encoded in the stack maps.";
return false;
}
if (!same_dex_file && current->NeedsDexCacheOfDeclaringClass()) {
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because " << current->DebugName()
- << " it is in a different dex file and requires access to the dex cache";
+ LOG_FAIL(kNotInlinedDexCache)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because " << current->DebugName()
+ << " it is in a different dex file and requires access to the dex cache";
return false;
}
@@ -1613,21 +1766,24 @@
current->IsUnresolvedStaticFieldSet() ||
current->IsUnresolvedInstanceFieldSet()) {
// Entrypoint for unresolved fields does not handle inlined frames.
- VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
- << " could not be inlined because it is using an unresolved"
- << " entrypoint";
+ LOG_FAIL(kNotInlinedUnresolvedEntrypoint)
+ << "Method " << callee_dex_file.PrettyMethod(method_index)
+ << " could not be inlined because it is using an unresolved"
+ << " entrypoint";
return false;
}
}
}
- number_of_inlined_instructions_ += number_of_instructions;
-
DCHECK_EQ(caller_instruction_counter, graph_->GetCurrentInstructionId())
<< "No instructions can be added to the outer graph while inner graph is being built";
+ // Inline the callee graph inside the caller graph.
const int32_t callee_instruction_counter = callee_graph->GetCurrentInstructionId();
graph_->SetCurrentInstructionId(callee_instruction_counter);
*return_replacement = callee_graph->InlineInto(graph_, invoke_instruction);
+ // Update our budget for other inlining attempts in `caller_graph`.
+ total_number_of_instructions_ += number_of_instructions;
+ UpdateInliningBudget();
DCHECK_EQ(callee_instruction_counter, callee_graph->GetCurrentInstructionId())
<< "No instructions can be added to the inner graph during inlining into the outer graph";
@@ -1640,9 +1796,9 @@
return true;
}
-size_t HInliner::RunOptimizations(HGraph* callee_graph,
- const DexFile::CodeItem* code_item,
- const DexCompilationUnit& dex_compilation_unit) {
+void HInliner::RunOptimizations(HGraph* callee_graph,
+ const DexFile::CodeItem* code_item,
+ const DexCompilationUnit& dex_compilation_unit) {
// Note: if the outermost_graph_ is being compiled OSR, we should not run any
// optimization that could lead to a HDeoptimize. The following optimizations do not.
HDeadCodeElimination dce(callee_graph, inline_stats_, "dead_code_elimination$inliner");
@@ -1664,23 +1820,37 @@
optimization->Run();
}
- size_t number_of_inlined_instructions = 0u;
- if (depth_ + 1 < compiler_driver_->GetCompilerOptions().GetInlineDepthLimit()) {
- HInliner inliner(callee_graph,
- outermost_graph_,
- codegen_,
- outer_compilation_unit_,
- dex_compilation_unit,
- compiler_driver_,
- handles_,
- inline_stats_,
- total_number_of_dex_registers_ + code_item->registers_size_,
- depth_ + 1);
- inliner.Run();
- number_of_inlined_instructions += inliner.number_of_inlined_instructions_;
+ // Bail early for pathological cases on the environment (for example recursive calls,
+ // or too large environment).
+ if (total_number_of_dex_registers_ >= kMaximumNumberOfCumulatedDexRegisters) {
+ LOG_NOTE() << "Calls in " << callee_graph->GetArtMethod()->PrettyMethod()
+ << " will not be inlined because the outer method has reached"
+ << " its environment budget limit.";
+ return;
}
- return number_of_inlined_instructions;
+ // Bail early if we know we already are over the limit.
+ size_t number_of_instructions = CountNumberOfInstructions(callee_graph);
+ if (number_of_instructions > inlining_budget_) {
+ LOG_NOTE() << "Calls in " << callee_graph->GetArtMethod()->PrettyMethod()
+ << " will not be inlined because the outer method has reached"
+ << " its instruction budget limit. " << number_of_instructions;
+ return;
+ }
+
+ HInliner inliner(callee_graph,
+ outermost_graph_,
+ codegen_,
+ outer_compilation_unit_,
+ dex_compilation_unit,
+ compiler_driver_,
+ handles_,
+ inline_stats_,
+ total_number_of_dex_registers_ + code_item->registers_size_,
+ total_number_of_instructions_ + number_of_instructions,
+ this,
+ depth_ + 1);
+ inliner.Run();
}
static bool IsReferenceTypeRefinement(ReferenceTypeInfo declared_rti,
diff --git a/compiler/optimizing/inliner.h b/compiler/optimizing/inliner.h
index a032042..9e4685c 100644
--- a/compiler/optimizing/inliner.h
+++ b/compiler/optimizing/inliner.h
@@ -42,7 +42,9 @@
VariableSizedHandleScope* handles,
OptimizingCompilerStats* stats,
size_t total_number_of_dex_registers,
- size_t depth)
+ size_t total_number_of_instructions,
+ HInliner* parent,
+ size_t depth = 0)
: HOptimization(outer_graph, kInlinerPassName, stats),
outermost_graph_(outermost_graph),
outer_compilation_unit_(outer_compilation_unit),
@@ -50,8 +52,10 @@
codegen_(codegen),
compiler_driver_(compiler_driver),
total_number_of_dex_registers_(total_number_of_dex_registers),
+ total_number_of_instructions_(total_number_of_instructions),
+ parent_(parent),
depth_(depth),
- number_of_inlined_instructions_(0),
+ inlining_budget_(0),
handles_(handles),
inline_stats_(nullptr) {}
@@ -95,10 +99,10 @@
HInstruction** return_replacement);
// Run simple optimizations on `callee_graph`.
- // Returns the number of inlined instructions.
- size_t RunOptimizations(HGraph* callee_graph,
- const DexFile::CodeItem* code_item,
- const DexCompilationUnit& dex_compilation_unit);
+ void RunOptimizations(HGraph* callee_graph,
+ const DexFile::CodeItem* code_item,
+ const DexCompilationUnit& dex_compilation_unit)
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Try to recognize known simple patterns and replace invoke call with appropriate instructions.
bool TryPatternSubstitution(HInvoke* invoke_instruction,
@@ -259,14 +263,30 @@
HInstruction* return_replacement,
HInstruction* invoke_instruction);
+ // Update the inlining budget based on `total_number_of_instructions_`.
+ void UpdateInliningBudget();
+
+ // Count the number of calls of `method` being inlined recursively.
+ size_t CountRecursiveCallsOf(ArtMethod* method) const;
+
+ // Pretty-print for spaces during logging.
+ std::string DepthString(int line) const;
+
HGraph* const outermost_graph_;
const DexCompilationUnit& outer_compilation_unit_;
const DexCompilationUnit& caller_compilation_unit_;
CodeGenerator* const codegen_;
CompilerDriver* const compiler_driver_;
const size_t total_number_of_dex_registers_;
+ size_t total_number_of_instructions_;
+
+ // The 'parent' inliner, that means the inlinigng optimization that requested
+ // `graph_` to be inlined.
+ const HInliner* const parent_;
const size_t depth_;
- size_t number_of_inlined_instructions_;
+
+ // The budget left for inlining, in number of instructions.
+ size_t inlining_budget_;
VariableSizedHandleScope* const handles_;
// Used to record stats about optimizations on the inlined graph.
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 17421fc..60790e5 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -2132,6 +2132,9 @@
if (cond->IsConstant()) {
if (cond->AsIntConstant()->IsFalse()) {
// Never deopt: instruction can be removed.
+ if (deoptimize->GuardsAnInput()) {
+ deoptimize->ReplaceWith(deoptimize->GuardedInput());
+ }
deoptimize->GetBlock()->RemoveInstruction(deoptimize);
} else {
// Always deopt.
diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc
index b25bad7..0d933ea 100644
--- a/compiler/optimizing/intrinsics_arm_vixl.cc
+++ b/compiler/optimizing/intrinsics_arm_vixl.cc
@@ -39,6 +39,7 @@
using helpers::LocationFrom;
using helpers::LowRegisterFrom;
using helpers::LowSRegisterFrom;
+using helpers::HighSRegisterFrom;
using helpers::OutputDRegister;
using helpers::OutputSRegister;
using helpers::OutputRegister;
@@ -794,6 +795,58 @@
__ Vrintn(F64, F64, OutputDRegister(invoke), InputDRegisterAt(invoke, 0));
}
+void IntrinsicLocationsBuilderARMVIXL::VisitMathRoundFloat(HInvoke* invoke) {
+ if (features_.HasARMv8AInstructions()) {
+ LocationSummary* locations = new (arena_) LocationSummary(invoke,
+ LocationSummary::kNoCall,
+ kIntrinsified);
+ locations->SetInAt(0, Location::RequiresFpuRegister());
+ locations->SetOut(Location::RequiresRegister());
+ locations->AddTemp(Location::RequiresFpuRegister());
+ }
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitMathRoundFloat(HInvoke* invoke) {
+ DCHECK(codegen_->GetInstructionSetFeatures().HasARMv8AInstructions());
+
+ ArmVIXLAssembler* assembler = GetAssembler();
+ vixl32::SRegister in_reg = InputSRegisterAt(invoke, 0);
+ vixl32::Register out_reg = OutputRegister(invoke);
+ vixl32::SRegister temp1 = LowSRegisterFrom(invoke->GetLocations()->GetTemp(0));
+ vixl32::SRegister temp2 = HighSRegisterFrom(invoke->GetLocations()->GetTemp(0));
+ vixl32::Label done;
+ vixl32::Label* final_label = codegen_->GetFinalLabel(invoke, &done);
+
+ // Round to nearest integer, ties away from zero.
+ __ Vcvta(S32, F32, temp1, in_reg);
+ __ Vmov(out_reg, temp1);
+
+ // For positive, zero or NaN inputs, rounding is done.
+ __ Cmp(out_reg, 0);
+ __ B(ge, final_label, /* far_target */ false);
+
+ // Handle input < 0 cases.
+ // If input is negative but not a tie, previous result (round to nearest) is valid.
+ // If input is a negative tie, change rounding direction to positive infinity, out_reg += 1.
+ __ Vrinta(F32, F32, temp1, in_reg);
+ __ Vmov(temp2, 0.5);
+ __ Vsub(F32, temp1, in_reg, temp1);
+ __ Vcmp(F32, temp1, temp2);
+ __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
+ {
+ // Use ExactAsemblyScope here because we are using IT.
+ ExactAssemblyScope it_scope(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ it(eq);
+ __ add(eq, out_reg, out_reg, 1);
+ }
+
+ if (done.IsReferenced()) {
+ __ Bind(&done);
+ }
+}
+
void IntrinsicLocationsBuilderARMVIXL::VisitMemoryPeekByte(HInvoke* invoke) {
CreateIntToIntLocations(arena_, invoke);
}
@@ -3100,7 +3153,6 @@
}
UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathRoundDouble) // Could be done by changing rounding mode, maybe?
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathRoundFloat) // Could be done by changing rounding mode, maybe?
UNIMPLEMENTED_INTRINSIC(ARMVIXL, UnsafeCASLong) // High register pressure.
UNIMPLEMENTED_INTRINSIC(ARMVIXL, SystemArrayCopyChar)
UNIMPLEMENTED_INTRINSIC(ARMVIXL, IntegerHighestOneBit)
diff --git a/compiler/optimizing/licm_test.cc b/compiler/optimizing/licm_test.cc
index 5bcfa4c..8d15f78 100644
--- a/compiler/optimizing/licm_test.cc
+++ b/compiler/optimizing/licm_test.cc
@@ -28,7 +28,18 @@
*/
class LICMTest : public CommonCompilerTest {
public:
- LICMTest() : pool_(), allocator_(&pool_) {
+ LICMTest()
+ : pool_(),
+ allocator_(&pool_),
+ entry_(nullptr),
+ loop_preheader_(nullptr),
+ loop_header_(nullptr),
+ loop_body_(nullptr),
+ return_(nullptr),
+ exit_(nullptr),
+ parameter_(nullptr),
+ int_constant_(nullptr),
+ float_constant_(nullptr) {
graph_ = CreateGraph(&allocator_);
}
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index ec706e6..caada8b 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -1088,6 +1088,19 @@
DCHECK(env_uses_.empty());
}
+void HInstruction::ReplaceUsesDominatedBy(HInstruction* dominator, HInstruction* replacement) {
+ const HUseList<HInstruction*>& uses = GetUses();
+ for (auto it = uses.begin(), end = uses.end(); it != end; /* ++it below */) {
+ HInstruction* user = it->GetUser();
+ size_t index = it->GetIndex();
+ // Increment `it` now because `*it` may disappear thanks to user->ReplaceInput().
+ ++it;
+ if (dominator->StrictlyDominates(user)) {
+ user->ReplaceInput(replacement, index);
+ }
+ }
+}
+
void HInstruction::ReplaceInput(HInstruction* replacement, size_t index) {
HUserRecord<HInstruction*> input_use = InputRecordAt(index);
if (input_use.GetInstruction() == replacement) {
@@ -1323,6 +1336,18 @@
}
}
+std::ostream& operator<<(std::ostream& os, const HDeoptimize::Kind& rhs) {
+ switch (rhs) {
+ case HDeoptimize::Kind::kBCE:
+ return os << "bce";
+ case HDeoptimize::Kind::kInline:
+ return os << "inline";
+ default:
+ LOG(FATAL) << "Unknown Deoptimization kind: " << static_cast<int>(rhs);
+ UNREACHABLE();
+ }
+}
+
bool HCondition::IsBeforeWhenDisregardMoves(HInstruction* instruction) const {
return this == instruction->GetPreviousDisregardingMoves();
}
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index 6881d8f..5f5a28c 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -341,6 +341,7 @@
cached_long_constants_(std::less<int64_t>(), arena->Adapter(kArenaAllocConstantsMap)),
cached_double_constants_(std::less<int64_t>(), arena->Adapter(kArenaAllocConstantsMap)),
cached_current_method_(nullptr),
+ art_method_(nullptr),
inexact_object_rti_(ReferenceTypeInfo::CreateInvalid()),
osr_(osr),
cha_single_implementation_list_(arena->Adapter(kArenaAllocCHA)) {
@@ -2080,6 +2081,7 @@
void SetLocations(LocationSummary* locations) { locations_ = locations; }
void ReplaceWith(HInstruction* instruction);
+ void ReplaceUsesDominatedBy(HInstruction* dominator, HInstruction* replacement);
void ReplaceInput(HInstruction* replacement, size_t index);
// This is almost the same as doing `ReplaceWith()`. But in this helper, the
@@ -2943,28 +2945,97 @@
};
// Deoptimize to interpreter, upon checking a condition.
-class HDeoptimize FINAL : public HTemplateInstruction<1> {
+class HDeoptimize FINAL : public HVariableInputSizeInstruction {
public:
- // We set CanTriggerGC to prevent any intermediate address to be live
- // at the point of the `HDeoptimize`.
- HDeoptimize(HInstruction* cond, uint32_t dex_pc)
- : HTemplateInstruction(SideEffects::CanTriggerGC(), dex_pc) {
+ enum class Kind {
+ kBCE,
+ kInline,
+ kLast = kInline
+ };
+
+ // Use this constructor when the `HDeoptimize` acts as a barrier, where no code can move
+ // across.
+ HDeoptimize(ArenaAllocator* arena, HInstruction* cond, Kind kind, uint32_t dex_pc)
+ : HVariableInputSizeInstruction(
+ SideEffects::All(),
+ dex_pc,
+ arena,
+ /* number_of_inputs */ 1,
+ kArenaAllocMisc) {
+ SetPackedFlag<kFieldCanBeMoved>(false);
+ SetPackedField<DeoptimizeKindField>(kind);
SetRawInputAt(0, cond);
}
- bool CanBeMoved() const OVERRIDE { return true; }
- bool InstructionDataEquals(const HInstruction* other ATTRIBUTE_UNUSED) const OVERRIDE {
- return true;
+ // Use this constructor when the `HDeoptimize` guards an instruction, and any user
+ // that relies on the deoptimization to pass should have its input be the `HDeoptimize`
+ // instead of `guard`.
+ // We set CanTriggerGC to prevent any intermediate address to be live
+ // at the point of the `HDeoptimize`.
+ HDeoptimize(ArenaAllocator* arena,
+ HInstruction* cond,
+ HInstruction* guard,
+ Kind kind,
+ uint32_t dex_pc)
+ : HVariableInputSizeInstruction(
+ SideEffects::CanTriggerGC(),
+ dex_pc,
+ arena,
+ /* number_of_inputs */ 2,
+ kArenaAllocMisc) {
+ SetPackedFlag<kFieldCanBeMoved>(true);
+ SetPackedField<DeoptimizeKindField>(kind);
+ SetRawInputAt(0, cond);
+ SetRawInputAt(1, guard);
}
+
+ bool CanBeMoved() const OVERRIDE { return GetPackedFlag<kFieldCanBeMoved>(); }
+
+ bool InstructionDataEquals(const HInstruction* other) const OVERRIDE {
+ return (other->CanBeMoved() == CanBeMoved()) && (other->AsDeoptimize()->GetKind() == GetKind());
+ }
+
bool NeedsEnvironment() const OVERRIDE { return true; }
+
bool CanThrow() const OVERRIDE { return true; }
+ Kind GetKind() const { return GetPackedField<DeoptimizeKindField>(); }
+
+ Primitive::Type GetType() const OVERRIDE {
+ return GuardsAnInput() ? GuardedInput()->GetType() : Primitive::kPrimVoid;
+ }
+
+ bool GuardsAnInput() const {
+ return InputCount() == 2;
+ }
+
+ HInstruction* GuardedInput() const {
+ DCHECK(GuardsAnInput());
+ return InputAt(1);
+ }
+
+ void RemoveGuard() {
+ RemoveInputAt(1);
+ }
+
DECLARE_INSTRUCTION(Deoptimize);
private:
+ static constexpr size_t kFieldCanBeMoved = kNumberOfGenericPackedBits;
+ static constexpr size_t kFieldDeoptimizeKind = kNumberOfGenericPackedBits + 1;
+ static constexpr size_t kFieldDeoptimizeKindSize =
+ MinimumBitsToStore(static_cast<size_t>(Kind::kLast));
+ static constexpr size_t kNumberOfDeoptimizePackedBits =
+ kFieldDeoptimizeKind + kFieldDeoptimizeKindSize;
+ static_assert(kNumberOfDeoptimizePackedBits <= kMaxNumberOfPackedBits,
+ "Too many packed fields.");
+ using DeoptimizeKindField = BitField<Kind, kFieldDeoptimizeKind, kFieldDeoptimizeKindSize>;
+
DISALLOW_COPY_AND_ASSIGN(HDeoptimize);
};
+std::ostream& operator<<(std::ostream& os, const HDeoptimize::Kind& rhs);
+
// Represents a should_deoptimize flag. Currently used for CHA-based devirtualization.
// The compiled code checks this flag value in a guard before devirtualized call and
// if it's true, starts to do deoptimization.
diff --git a/compiler/optimizing/optimizing_cfi_test_expected.inc b/compiler/optimizing/optimizing_cfi_test_expected.inc
index d84fe6c..60af2b4 100644
--- a/compiler/optimizing/optimizing_cfi_test_expected.inc
+++ b/compiler/optimizing/optimizing_cfi_test_expected.inc
@@ -174,53 +174,45 @@
// 0x00000034: .cfi_def_cfa_offset: 64
static constexpr uint8_t expected_asm_kMips64[] = {
- 0xD8, 0xFF, 0xBD, 0x67, 0x20, 0x00, 0xBF, 0xFF, 0x18, 0x00, 0xB1, 0xFF,
- 0x10, 0x00, 0xB0, 0xFF, 0x08, 0x00, 0xB9, 0xF7, 0x00, 0x00, 0xB8, 0xF7,
- 0xE8, 0xFF, 0xBD, 0x67, 0x18, 0x00, 0xBD, 0x67,
- 0x00, 0x00, 0xB8, 0xD7, 0x08, 0x00, 0xB9, 0xD7, 0x10, 0x00, 0xB0, 0xDF,
- 0x18, 0x00, 0xB1, 0xDF, 0x20, 0x00, 0xBF, 0xDF, 0x28, 0x00, 0xBD, 0x67,
- 0x09, 0x00, 0xE0, 0x03, 0x00, 0x00, 0x00, 0x00,
+ 0xC0, 0xFF, 0xBD, 0x67, 0x38, 0x00, 0xBF, 0xFF, 0x30, 0x00, 0xB1, 0xFF,
+ 0x28, 0x00, 0xB0, 0xFF, 0x20, 0x00, 0xB9, 0xF7, 0x18, 0x00, 0xB8, 0xF7,
+ 0x38, 0x00, 0xBF, 0xDF, 0x30, 0x00, 0xB1, 0xDF, 0x28, 0x00, 0xB0, 0xDF,
+ 0x20, 0x00, 0xB9, 0xD7, 0x18, 0x00, 0xB8, 0xD7, 0x40, 0x00, 0xBD, 0x67,
+ 0x00, 0x00, 0x1F, 0xD8,
};
-
static constexpr uint8_t expected_cfi_kMips64[] = {
- 0x44, 0x0E, 0x28, 0x44, 0x9F, 0x02, 0x44, 0x91, 0x04, 0x44, 0x90, 0x06,
- 0x44, 0xB9, 0x08, 0x44, 0xB8, 0x0A, 0x44, 0x0E, 0x40, 0x0A, 0x44,
- 0x0E, 0x28, 0x44, 0xF8, 0x44, 0xF9, 0x44, 0xD0, 0x44, 0xD1, 0x44, 0xDF,
- 0x44, 0x0E, 0x00, 0x48, 0x0B, 0x0E, 0x40,
+ 0x44, 0x0E, 0x40, 0x44, 0x9F, 0x02, 0x44, 0x91, 0x04, 0x44, 0x90, 0x06,
+ 0x44, 0xB9, 0x08, 0x44, 0xB8, 0x0A, 0x0A, 0x44, 0xDF, 0x44, 0xD1, 0x44,
+ 0xD0, 0x44, 0xF9, 0x44, 0xF8, 0x44, 0x0E, 0x00, 0x44, 0x0B, 0x0E, 0x40,
};
-// 0x00000000: daddiu r29, r29, -40
-// 0x00000004: .cfi_def_cfa_offset: 40
-// 0x00000004: sd r31, +32(r29)
+// 0x00000000: daddiu r29, r29, -64
+// 0x00000004: .cfi_def_cfa_offset: 64
+// 0x00000004: sd r31, +56(r29)
// 0x00000008: .cfi_offset: r31 at cfa-8
-// 0x00000008: sd r17, +24(r29)
+// 0x00000008: sd r17, +48(r29)
// 0x0000000c: .cfi_offset: r17 at cfa-16
-// 0x0000000c: sd r16, +16(r29)
+// 0x0000000c: sd r16, +40(r29)
// 0x00000010: .cfi_offset: r16 at cfa-24
-// 0x00000010: sdc1 f25, +8(r29)
+// 0x00000010: sdc1 f25, +32(r29)
// 0x00000014: .cfi_offset: r57 at cfa-32
-// 0x00000014: sdc1 f24, +0(r29)
+// 0x00000014: sdc1 f24, +24(r29)
// 0x00000018: .cfi_offset: r56 at cfa-40
-// 0x00000018: daddiu r29, r29, -24
-// 0x0000001c: .cfi_def_cfa_offset: 64
-// 0x0000001c: .cfi_remember_state
-// 0x0000001c: daddiu r29, r29, 24
-// 0x00000020: .cfi_def_cfa_offset: 40
-// 0x00000020: ldc1 f24, +0(r29)
-// 0x00000024: .cfi_restore: r56
-// 0x00000024: ldc1 f25, +8(r29)
+// 0x00000018: .cfi_remember_state
+// 0x00000018: ld r31, +56(r29)
+// 0x0000001c: .cfi_restore: r31
+// 0x0000001c: ld r17, +48(r29)
+// 0x00000020: .cfi_restore: r17
+// 0x00000020: ld r16, +40(r29)
+// 0x00000024: .cfi_restore: r16
+// 0x00000024: ldc1 f25, +32(r29)
// 0x00000028: .cfi_restore: r57
-// 0x00000028: ld r16, +16(r29)
-// 0x0000002c: .cfi_restore: r16
-// 0x0000002c: ld r17, +24(r29)
-// 0x00000030: .cfi_restore: r17
-// 0x00000030: ld r31, +32(r29)
-// 0x00000034: .cfi_restore: r31
-// 0x00000034: daddiu r29, r29, 40
-// 0x00000038: .cfi_def_cfa_offset: 0
-// 0x00000038: jr r31
-// 0x0000003c: nop
-// 0x00000040: .cfi_restore_state
-// 0x00000040: .cfi_def_cfa_offset: 64
+// 0x00000028: ldc1 f24, +24(r29)
+// 0x0000002c: .cfi_restore: r56
+// 0x0000002c: daddiu r29, r29, 64
+// 0x00000030: .cfi_def_cfa_offset: 0
+// 0x00000030: jic r31, 0
+// 0x00000034: .cfi_restore_state
+// 0x00000034: .cfi_def_cfa_offset: 64
static constexpr uint8_t expected_asm_kThumb2_adjust[] = {
#ifdef ART_USE_OLD_ARM_BACKEND
@@ -403,58 +395,52 @@
// 0x00020060: .cfi_def_cfa_offset: 64
static constexpr uint8_t expected_asm_kMips64_adjust_head[] = {
- 0xD8, 0xFF, 0xBD, 0x67, 0x20, 0x00, 0xBF, 0xFF, 0x18, 0x00, 0xB1, 0xFF,
- 0x10, 0x00, 0xB0, 0xFF, 0x08, 0x00, 0xB9, 0xF7, 0x00, 0x00, 0xB8, 0xF7,
- 0xE8, 0xFF, 0xBD, 0x67, 0x02, 0x00, 0xA6, 0x60,
- 0x02, 0x00, 0x3E, 0xEC, 0x0C, 0x00, 0x01, 0xD8,
+ 0xC0, 0xFF, 0xBD, 0x67, 0x38, 0x00, 0xBF, 0xFF, 0x30, 0x00, 0xB1, 0xFF,
+ 0x28, 0x00, 0xB0, 0xFF, 0x20, 0x00, 0xB9, 0xF7, 0x18, 0x00, 0xB8, 0xF7,
+ 0x02, 0x00, 0xA6, 0x60, 0x02, 0x00, 0x3E, 0xEC, 0x0C, 0x00, 0x01, 0xD8,
};
static constexpr uint8_t expected_asm_kMips64_adjust_tail[] = {
- 0x18, 0x00, 0xBD, 0x67, 0x00, 0x00, 0xB8, 0xD7, 0x08, 0x00, 0xB9, 0xD7,
- 0x10, 0x00, 0xB0, 0xDF, 0x18, 0x00, 0xB1, 0xDF, 0x20, 0x00, 0xBF, 0xDF,
- 0x28, 0x00, 0xBD, 0x67, 0x09, 0x00, 0xE0, 0x03, 0x00, 0x00, 0x00, 0x00,
+ 0x38, 0x00, 0xBF, 0xDF, 0x30, 0x00, 0xB1, 0xDF, 0x28, 0x00, 0xB0, 0xDF,
+ 0x20, 0x00, 0xB9, 0xD7, 0x18, 0x00, 0xB8, 0xD7, 0x40, 0x00, 0xBD, 0x67,
+ 0x00, 0x00, 0x1F, 0xD8,
};
static constexpr uint8_t expected_cfi_kMips64_adjust[] = {
- 0x44, 0x0E, 0x28, 0x44, 0x9F, 0x02, 0x44, 0x91, 0x04, 0x44, 0x90, 0x06,
- 0x44, 0xB9, 0x08, 0x44, 0xB8, 0x0A, 0x44, 0x0E, 0x40, 0x04, 0x10, 0x00,
- 0x02, 0x00, 0x0A, 0x44, 0x0E, 0x28, 0x44, 0xF8, 0x44, 0xF9, 0x44, 0xD0,
- 0x44, 0xD1, 0x44, 0xDF, 0x44, 0x0E, 0x00, 0x48, 0x0B, 0x0E, 0x40,
+ 0x44, 0x0E, 0x40, 0x44, 0x9F, 0x02, 0x44, 0x91, 0x04, 0x44, 0x90, 0x06,
+ 0x44, 0xB9, 0x08, 0x44, 0xB8, 0x0A, 0x04, 0x10, 0x00, 0x02, 0x00, 0x0A,
+ 0x44, 0xDF, 0x44, 0xD1, 0x44, 0xD0, 0x44, 0xF9, 0x44, 0xF8, 0x44, 0x0E,
+ 0x00, 0x44, 0x0B, 0x0E, 0x40,
};
-// 0x00000000: daddiu r29, r29, -40
-// 0x00000004: .cfi_def_cfa_offset: 40
-// 0x00000004: sd r31, +32(r29)
+// 0x00000000: daddiu r29, r29, -64
+// 0x00000004: .cfi_def_cfa_offset: 64
+// 0x00000004: sd r31, +56(r29)
// 0x00000008: .cfi_offset: r31 at cfa-8
-// 0x00000008: sd r17, +24(r29)
+// 0x00000008: sd r17, +48(r29)
// 0x0000000c: .cfi_offset: r17 at cfa-16
-// 0x0000000c: sd r16, +16(r29)
+// 0x0000000c: sd r16, +40(r29)
// 0x00000010: .cfi_offset: r16 at cfa-24
-// 0x00000010: sdc1 f25, +8(r29)
+// 0x00000010: sdc1 f25, +32(r29)
// 0x00000014: .cfi_offset: r57 at cfa-32
-// 0x00000014: sdc1 f24, +0(r29)
+// 0x00000014: sdc1 f24, +24(r29)
// 0x00000018: .cfi_offset: r56 at cfa-40
-// 0x00000018: daddiu r29, r29, -24
-// 0x0000001c: .cfi_def_cfa_offset: 64
-// 0x0000001c: bnec r5, r6, 0x0000002c ; +12
-// 0x00000020: auipc r1, 2
-// 0x00000024: jic r1, 12 ; b 0x00020030 ; +131080
-// 0x00000028: nop
+// 0x00000018: bnec r5, r6, 0x00000024 ; +12
+// 0x0000001c: auipc r1, 2
+// 0x00000020: jic r1, 12 ; bc 0x00020028 ; +131080
+// 0x00000024: nop
// ...
-// 0x00020028: nop
-// 0x0002002c: .cfi_remember_state
-// 0x0002002c: daddiu r29, r29, 24
-// 0x00020030: .cfi_def_cfa_offset: 40
-// 0x00020030: ldc1 f24, +0(r29)
-// 0x00020034: .cfi_restore: r56
-// 0x00020034: ldc1 f25, +8(r29)
+// 0x00020024: nop
+// 0x00020028: .cfi_remember_state
+// 0x00020028: ld r31, +56(r29)
+// 0x0002002c: .cfi_restore: r31
+// 0x0002002c: ld r17, +48(r29)
+// 0x00020030: .cfi_restore: r17
+// 0x00020030: ld r16, +40(r29)
+// 0x00020034: .cfi_restore: r16
+// 0x00020034: ldc1 f25, +32(r29)
// 0x00020038: .cfi_restore: r57
-// 0x00020038: ld r16, +16(r29)
-// 0x0002003c: .cfi_restore: r16
-// 0x0002003c: ld r17, +24(r29)
-// 0x00020040: .cfi_restore: r17
-// 0x00020040: ld r31, +32(r29)
-// 0x00020044: .cfi_restore: r31
-// 0x00020044: daddiu r29, r29, 40
-// 0x00020047: .cfi_def_cfa_offset: 0
-// 0x00020048: jr r31
-// 0x0002004c: nop
-// 0x00020050: .cfi_restore_state
-// 0x00020050: .cfi_def_cfa_offset: 64
+// 0x00020038: ldc1 f24, +24(r29)
+// 0x0002003c: .cfi_restore: r56
+// 0x0002003c: daddiu r29, r29, 64
+// 0x00020040: .cfi_def_cfa_offset: 0
+// 0x00020040: jic r31, 0
+// 0x00020044: .cfi_restore_state
+// 0x00020044: .cfi_def_cfa_offset: 64
diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc
index 23ccd9e..3c6d2d6 100644
--- a/compiler/optimizing/optimizing_compiler.cc
+++ b/compiler/optimizing/optimizing_compiler.cc
@@ -499,7 +499,8 @@
handles,
stats,
number_of_dex_registers,
- /* depth */ 0);
+ /* total_number_of_instructions */ 0,
+ /* parent */ nullptr);
} else if (opt_name == HSharpening::kSharpeningPassName) {
return new (arena) HSharpening(graph, codegen, dex_compilation_unit, driver, handles);
} else if (opt_name == HSelectGenerator::kSelectGeneratorPassName) {
@@ -607,8 +608,7 @@
VariableSizedHandleScope* handles) const {
OptimizingCompilerStats* stats = compilation_stats_.get();
const CompilerOptions& compiler_options = driver->GetCompilerOptions();
- bool should_inline = (compiler_options.GetInlineDepthLimit() > 0)
- && (compiler_options.GetInlineMaxCodeUnits() > 0);
+ bool should_inline = (compiler_options.GetInlineMaxCodeUnits() > 0);
if (!should_inline) {
return;
}
@@ -623,7 +623,8 @@
handles,
stats,
number_of_dex_registers,
- /* depth */ 0);
+ /* total_number_of_instructions */ 0,
+ /* parent */ nullptr);
HOptimization* optimizations[] = { inliner };
RunOptimizations(optimizations, arraysize(optimizations), pass_observer);
diff --git a/compiler/optimizing/optimizing_compiler_stats.h b/compiler/optimizing/optimizing_compiler_stats.h
index ae9a811..a211c54 100644
--- a/compiler/optimizing/optimizing_compiler_stats.h
+++ b/compiler/optimizing/optimizing_compiler_stats.h
@@ -69,6 +69,23 @@
kExplicitNullCheckGenerated,
kSimplifyIf,
kInstructionSunk,
+ kNotInlinedUnresolvedEntrypoint,
+ kNotInlinedDexCache,
+ kNotInlinedStackMaps,
+ kNotInlinedEnvironmentBudget,
+ kNotInlinedInstructionBudget,
+ kNotInlinedLoopWithoutExit,
+ kNotInlinedIrreducibleLoop,
+ kNotInlinedAlwaysThrows,
+ kNotInlinedInfiniteLoop,
+ kNotInlinedTryCatch,
+ kNotInlinedRegisterAllocator,
+ kNotInlinedCannotBuild,
+ kNotInlinedNotVerified,
+ kNotInlinedCodeItem,
+ kNotInlinedWont,
+ kNotInlinedRecursiveBudget,
+ kNotInlinedProxy,
kLastStat
};
@@ -168,6 +185,23 @@
case kExplicitNullCheckGenerated: name = "ExplicitNullCheckGenerated"; break;
case kSimplifyIf: name = "SimplifyIf"; break;
case kInstructionSunk: name = "InstructionSunk"; break;
+ case kNotInlinedUnresolvedEntrypoint: name = "NotInlinedUnresolvedEntrypoint"; break;
+ case kNotInlinedDexCache: name = "NotInlinedDexCache"; break;
+ case kNotInlinedStackMaps: name = "NotInlinedStackMaps"; break;
+ case kNotInlinedEnvironmentBudget: name = "NotInlinedEnvironmentBudget"; break;
+ case kNotInlinedInstructionBudget: name = "NotInlinedInstructionBudget"; break;
+ case kNotInlinedLoopWithoutExit: name = "NotInlinedLoopWithoutExit"; break;
+ case kNotInlinedIrreducibleLoop: name = "NotInlinedIrreducibleLoop"; break;
+ case kNotInlinedAlwaysThrows: name = "NotInlinedAlwaysThrows"; break;
+ case kNotInlinedInfiniteLoop: name = "NotInlinedInfiniteLoop"; break;
+ case kNotInlinedTryCatch: name = "NotInlinedTryCatch"; break;
+ case kNotInlinedRegisterAllocator: name = "NotInlinedRegisterAllocator"; break;
+ case kNotInlinedCannotBuild: name = "NotInlinedCannotBuild"; break;
+ case kNotInlinedNotVerified: name = "NotInlinedNotVerified"; break;
+ case kNotInlinedCodeItem: name = "NotInlinedCodeItem"; break;
+ case kNotInlinedWont: name = "NotInlinedWont"; break;
+ case kNotInlinedRecursiveBudget: name = "NotInlinedRecursiveBudget"; break;
+ case kNotInlinedProxy: name = "NotInlinedProxy"; break;
case kLastStat:
LOG(FATAL) << "invalid stat "
diff --git a/compiler/optimizing/prepare_for_register_allocation.cc b/compiler/optimizing/prepare_for_register_allocation.cc
index efbaf6c..66bfea9 100644
--- a/compiler/optimizing/prepare_for_register_allocation.cc
+++ b/compiler/optimizing/prepare_for_register_allocation.cc
@@ -40,6 +40,14 @@
check->ReplaceWith(check->InputAt(0));
}
+void PrepareForRegisterAllocation::VisitDeoptimize(HDeoptimize* deoptimize) {
+ if (deoptimize->GuardsAnInput()) {
+ // Replace the uses with the actual guarded instruction.
+ deoptimize->ReplaceWith(deoptimize->GuardedInput());
+ deoptimize->RemoveGuard();
+ }
+}
+
void PrepareForRegisterAllocation::VisitBoundsCheck(HBoundsCheck* check) {
check->ReplaceWith(check->InputAt(0));
if (check->IsStringCharAt()) {
diff --git a/compiler/optimizing/prepare_for_register_allocation.h b/compiler/optimizing/prepare_for_register_allocation.h
index c128227..7ffbe44 100644
--- a/compiler/optimizing/prepare_for_register_allocation.h
+++ b/compiler/optimizing/prepare_for_register_allocation.h
@@ -44,6 +44,7 @@
void VisitClinitCheck(HClinitCheck* check) OVERRIDE;
void VisitCondition(HCondition* condition) OVERRIDE;
void VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) OVERRIDE;
+ void VisitDeoptimize(HDeoptimize* deoptimize) OVERRIDE;
bool CanMoveClinitCheck(HInstruction* input, HInstruction* user) const;
bool CanEmitConditionAt(HCondition* condition, HInstruction* user) const;
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index 6e332ca..d5637b9 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -310,8 +310,8 @@
BoundTypeIn(receiver, trueBlock, /* start_instruction */ nullptr, class_rti);
} else {
DCHECK(check->IsDeoptimize());
- if (compare->IsEqual()) {
- BoundTypeIn(receiver, check->GetBlock(), check, class_rti);
+ if (compare->IsEqual() && check->AsDeoptimize()->GuardsAnInput()) {
+ check->SetReferenceTypeInfo(class_rti);
}
}
}
diff --git a/compiler/optimizing/reference_type_propagation_test.cc b/compiler/optimizing/reference_type_propagation_test.cc
index 84a4bab..0b49ce1 100644
--- a/compiler/optimizing/reference_type_propagation_test.cc
+++ b/compiler/optimizing/reference_type_propagation_test.cc
@@ -29,7 +29,7 @@
*/
class ReferenceTypePropagationTest : public CommonCompilerTest {
public:
- ReferenceTypePropagationTest() : pool_(), allocator_(&pool_) {
+ ReferenceTypePropagationTest() : pool_(), allocator_(&pool_), propagation_(nullptr) {
graph_ = CreateGraph(&allocator_);
}
diff --git a/compiler/optimizing/scheduler.h b/compiler/optimizing/scheduler.h
index ab0dad4..9236a0e 100644
--- a/compiler/optimizing/scheduler.h
+++ b/compiler/optimizing/scheduler.h
@@ -315,7 +315,10 @@
// This class and its sub-classes will never be used to drive a visit of an
// `HGraph` but only to visit `HInstructions` one at a time, so we do not need
// to pass a valid graph to `HGraphDelegateVisitor()`.
- SchedulingLatencyVisitor() : HGraphDelegateVisitor(nullptr) {}
+ SchedulingLatencyVisitor()
+ : HGraphDelegateVisitor(nullptr),
+ last_visited_latency_(0),
+ last_visited_internal_latency_(0) {}
void VisitInstruction(HInstruction* instruction) OVERRIDE {
LOG(FATAL) << "Error visiting " << instruction->DebugName() << ". "
@@ -413,6 +416,7 @@
selector_(selector),
only_optimize_loop_blocks_(true),
scheduling_graph_(this, arena),
+ cursor_(nullptr),
candidates_(arena_->Adapter(kArenaAllocScheduler)) {}
virtual ~HScheduler() {}
diff --git a/compiler/optimizing/ssa_liveness_analysis_test.cc b/compiler/optimizing/ssa_liveness_analysis_test.cc
index 1916c73..a1016d1 100644
--- a/compiler/optimizing/ssa_liveness_analysis_test.cc
+++ b/compiler/optimizing/ssa_liveness_analysis_test.cc
@@ -189,13 +189,14 @@
// Use HAboveOrEqual+HDeoptimize as the bounds check.
HInstruction* ae = new (&allocator_) HAboveOrEqual(index, length);
block->AddInstruction(ae);
- HInstruction* deoptimize = new(&allocator_) HDeoptimize(ae, /* dex_pc */ 0u);
+ HInstruction* deoptimize =
+ new(&allocator_) HDeoptimize(&allocator_, ae, HDeoptimize::Kind::kBCE, /* dex_pc */ 0u);
block->AddInstruction(deoptimize);
HEnvironment* deoptimize_env = new (&allocator_) HEnvironment(&allocator_,
- /* number_of_vregs */ 5,
- /* method */ nullptr,
- /* dex_pc */ 0u,
- deoptimize);
+ /* number_of_vregs */ 5,
+ /* method */ nullptr,
+ /* dex_pc */ 0u,
+ deoptimize);
deoptimize_env->CopyFrom(args);
deoptimize->SetRawEnvironment(deoptimize_env);
HInstruction* array_set =
diff --git a/compiler/utils/mips64/managed_register_mips64.cc b/compiler/utils/mips64/managed_register_mips64.cc
index dea396e..42d061e 100644
--- a/compiler/utils/mips64/managed_register_mips64.cc
+++ b/compiler/utils/mips64/managed_register_mips64.cc
@@ -26,6 +26,11 @@
CHECK(IsValidManagedRegister());
CHECK(other.IsValidManagedRegister());
if (Equals(other)) return true;
+ if (IsFpuRegister() && other.IsVectorRegister()) {
+ return (AsFpuRegister() == other.AsOverlappingFpuRegister());
+ } else if (IsVectorRegister() && other.IsFpuRegister()) {
+ return (AsVectorRegister() == other.AsOverlappingVectorRegister());
+ }
return false;
}
@@ -36,6 +41,8 @@
os << "GPU: " << static_cast<int>(AsGpuRegister());
} else if (IsFpuRegister()) {
os << "FpuRegister: " << static_cast<int>(AsFpuRegister());
+ } else if (IsVectorRegister()) {
+ os << "VectorRegister: " << static_cast<int>(AsVectorRegister());
} else {
os << "??: " << RegId();
}
diff --git a/compiler/utils/mips64/managed_register_mips64.h b/compiler/utils/mips64/managed_register_mips64.h
index c9f9556..3980199 100644
--- a/compiler/utils/mips64/managed_register_mips64.h
+++ b/compiler/utils/mips64/managed_register_mips64.h
@@ -30,11 +30,27 @@
const int kNumberOfFpuRegIds = kNumberOfFpuRegisters;
const int kNumberOfFpuAllocIds = kNumberOfFpuRegisters;
-const int kNumberOfRegIds = kNumberOfGpuRegIds + kNumberOfFpuRegIds;
-const int kNumberOfAllocIds = kNumberOfGpuAllocIds + kNumberOfFpuAllocIds;
+const int kNumberOfVecRegIds = kNumberOfVectorRegisters;
+const int kNumberOfVecAllocIds = kNumberOfVectorRegisters;
-// An instance of class 'ManagedRegister' represents a single GPU register (enum
-// Register) or a double precision FP register (enum FpuRegister)
+const int kNumberOfRegIds = kNumberOfGpuRegIds + kNumberOfFpuRegIds + kNumberOfVecRegIds;
+const int kNumberOfAllocIds = kNumberOfGpuAllocIds + kNumberOfFpuAllocIds + kNumberOfVecAllocIds;
+
+// Register ids map:
+// [0..R[ core registers (enum GpuRegister)
+// [R..F[ floating-point registers (enum FpuRegister)
+// [F..W[ MSA vector registers (enum VectorRegister)
+// where
+// R = kNumberOfGpuRegIds
+// F = R + kNumberOfFpuRegIds
+// W = F + kNumberOfVecRegIds
+
+// An instance of class 'ManagedRegister' represents a single Mips64 register.
+// A register can be one of the following:
+// * core register (enum GpuRegister)
+// * floating-point register (enum FpuRegister)
+// * MSA vector register (enum VectorRegister)
+//
// 'ManagedRegister::NoRegister()' provides an invalid register.
// There is a one-to-one mapping between ManagedRegister and register id.
class Mips64ManagedRegister : public ManagedRegister {
@@ -49,6 +65,21 @@
return static_cast<FpuRegister>(id_ - kNumberOfGpuRegIds);
}
+ constexpr VectorRegister AsVectorRegister() const {
+ CHECK(IsVectorRegister());
+ return static_cast<VectorRegister>(id_ - (kNumberOfGpuRegIds + kNumberOfFpuRegisters));
+ }
+
+ constexpr FpuRegister AsOverlappingFpuRegister() const {
+ CHECK(IsValidManagedRegister());
+ return static_cast<FpuRegister>(AsVectorRegister());
+ }
+
+ constexpr VectorRegister AsOverlappingVectorRegister() const {
+ CHECK(IsValidManagedRegister());
+ return static_cast<VectorRegister>(AsFpuRegister());
+ }
+
constexpr bool IsGpuRegister() const {
CHECK(IsValidManagedRegister());
return (0 <= id_) && (id_ < kNumberOfGpuRegIds);
@@ -60,6 +91,12 @@
return (0 <= test) && (test < kNumberOfFpuRegIds);
}
+ constexpr bool IsVectorRegister() const {
+ CHECK(IsValidManagedRegister());
+ const int test = id_ - (kNumberOfGpuRegIds + kNumberOfFpuRegIds);
+ return (0 <= test) && (test < kNumberOfVecRegIds);
+ }
+
void Print(std::ostream& os) const;
// Returns true if the two managed-registers ('this' and 'other') overlap.
@@ -77,6 +114,11 @@
return FromRegId(r + kNumberOfGpuRegIds);
}
+ static constexpr Mips64ManagedRegister FromVectorRegister(VectorRegister r) {
+ CHECK_NE(r, kNoVectorRegister);
+ return FromRegId(r + kNumberOfGpuRegIds + kNumberOfFpuRegIds);
+ }
+
private:
constexpr bool IsValidManagedRegister() const {
return (0 <= id_) && (id_ < kNumberOfRegIds);
diff --git a/compiler/utils/mips64/managed_register_mips64_test.cc b/compiler/utils/mips64/managed_register_mips64_test.cc
new file mode 100644
index 0000000..8b72d7e
--- /dev/null
+++ b/compiler/utils/mips64/managed_register_mips64_test.cc
@@ -0,0 +1,480 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "managed_register_mips64.h"
+#include "globals.h"
+#include "gtest/gtest.h"
+
+namespace art {
+namespace mips64 {
+
+TEST(Mips64ManagedRegister, NoRegister) {
+ Mips64ManagedRegister reg = ManagedRegister::NoRegister().AsMips64();
+ EXPECT_TRUE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.Overlaps(reg));
+}
+
+TEST(Mips64ManagedRegister, GpuRegister) {
+ Mips64ManagedRegister reg = Mips64ManagedRegister::FromGpuRegister(ZERO);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(ZERO, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(AT);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(AT, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(V0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(V0, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(A0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(A0, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(A7);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(A7, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(T0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(T0, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(T3);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(T3, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(S0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(S0, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(GP);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(GP, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(SP);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(SP, reg.AsGpuRegister());
+
+ reg = Mips64ManagedRegister::FromGpuRegister(RA);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_TRUE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_EQ(RA, reg.AsGpuRegister());
+}
+
+TEST(Mips64ManagedRegister, FpuRegister) {
+ Mips64ManagedRegister reg = Mips64ManagedRegister::FromFpuRegister(F0);
+ Mips64ManagedRegister vreg = Mips64ManagedRegister::FromVectorRegister(W0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_TRUE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(vreg));
+ EXPECT_EQ(F0, reg.AsFpuRegister());
+ EXPECT_EQ(W0, reg.AsOverlappingVectorRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F1);
+ vreg = Mips64ManagedRegister::FromVectorRegister(W1);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_TRUE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(vreg));
+ EXPECT_EQ(F1, reg.AsFpuRegister());
+ EXPECT_EQ(W1, reg.AsOverlappingVectorRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromFpuRegister(F1)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F20);
+ vreg = Mips64ManagedRegister::FromVectorRegister(W20);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_TRUE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(vreg));
+ EXPECT_EQ(F20, reg.AsFpuRegister());
+ EXPECT_EQ(W20, reg.AsOverlappingVectorRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromFpuRegister(F20)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F31);
+ vreg = Mips64ManagedRegister::FromVectorRegister(W31);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_TRUE(reg.IsFpuRegister());
+ EXPECT_FALSE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(vreg));
+ EXPECT_EQ(F31, reg.AsFpuRegister());
+ EXPECT_EQ(W31, reg.AsOverlappingVectorRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromFpuRegister(F31)));
+}
+
+TEST(Mips64ManagedRegister, VectorRegister) {
+ Mips64ManagedRegister reg = Mips64ManagedRegister::FromVectorRegister(W0);
+ Mips64ManagedRegister freg = Mips64ManagedRegister::FromFpuRegister(F0);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_TRUE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(freg));
+ EXPECT_EQ(W0, reg.AsVectorRegister());
+ EXPECT_EQ(F0, reg.AsOverlappingFpuRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W2);
+ freg = Mips64ManagedRegister::FromFpuRegister(F2);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_TRUE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(freg));
+ EXPECT_EQ(W2, reg.AsVectorRegister());
+ EXPECT_EQ(F2, reg.AsOverlappingFpuRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromVectorRegister(W2)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W13);
+ freg = Mips64ManagedRegister::FromFpuRegister(F13);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_TRUE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(freg));
+ EXPECT_EQ(W13, reg.AsVectorRegister());
+ EXPECT_EQ(F13, reg.AsOverlappingFpuRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromVectorRegister(W13)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W29);
+ freg = Mips64ManagedRegister::FromFpuRegister(F29);
+ EXPECT_FALSE(reg.IsNoRegister());
+ EXPECT_FALSE(reg.IsGpuRegister());
+ EXPECT_FALSE(reg.IsFpuRegister());
+ EXPECT_TRUE(reg.IsVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(freg));
+ EXPECT_EQ(W29, reg.AsVectorRegister());
+ EXPECT_EQ(F29, reg.AsOverlappingFpuRegister());
+ EXPECT_TRUE(reg.Equals(Mips64ManagedRegister::FromVectorRegister(W29)));
+}
+
+TEST(Mips64ManagedRegister, Equals) {
+ ManagedRegister no_reg = ManagedRegister::NoRegister();
+ EXPECT_TRUE(no_reg.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(no_reg.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(no_reg.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(no_reg.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_FALSE(no_reg.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(no_reg.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_ZERO = Mips64ManagedRegister::FromGpuRegister(ZERO);
+ EXPECT_FALSE(reg_ZERO.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_TRUE(reg_ZERO.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_ZERO.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_ZERO.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_FALSE(reg_ZERO.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_ZERO.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_A1 = Mips64ManagedRegister::FromGpuRegister(A1);
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_TRUE(reg_A1.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_A1.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_S2 = Mips64ManagedRegister::FromGpuRegister(S2);
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::FromGpuRegister(S1)));
+ EXPECT_TRUE(reg_S2.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_S2.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_F0 = Mips64ManagedRegister::FromFpuRegister(F0);
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_TRUE(reg_F0.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromFpuRegister(F1)));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg_F0.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_F31 = Mips64ManagedRegister::FromFpuRegister(F31);
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromGpuRegister(S2)));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromFpuRegister(F1)));
+ EXPECT_TRUE(reg_F31.Equals(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg_F31.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+
+ Mips64ManagedRegister reg_W0 = Mips64ManagedRegister::FromVectorRegister(W0);
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromGpuRegister(S1)));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_TRUE(reg_W0.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromVectorRegister(W1)));
+ EXPECT_FALSE(reg_W0.Equals(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ Mips64ManagedRegister reg_W31 = Mips64ManagedRegister::FromVectorRegister(W31);
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::NoRegister()));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromGpuRegister(A1)));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromGpuRegister(S1)));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg_W31.Equals(Mips64ManagedRegister::FromVectorRegister(W1)));
+ EXPECT_TRUE(reg_W31.Equals(Mips64ManagedRegister::FromVectorRegister(W31)));
+}
+
+TEST(Mips64ManagedRegister, Overlaps) {
+ Mips64ManagedRegister reg = Mips64ManagedRegister::FromFpuRegister(F0);
+ Mips64ManagedRegister reg_o = Mips64ManagedRegister::FromVectorRegister(W0);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(F0, reg_o.AsOverlappingFpuRegister());
+ EXPECT_EQ(W0, reg.AsOverlappingVectorRegister());
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F4);
+ reg_o = Mips64ManagedRegister::FromVectorRegister(W4);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(F4, reg_o.AsOverlappingFpuRegister());
+ EXPECT_EQ(W4, reg.AsOverlappingVectorRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F16);
+ reg_o = Mips64ManagedRegister::FromVectorRegister(W16);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(F16, reg_o.AsOverlappingFpuRegister());
+ EXPECT_EQ(W16, reg.AsOverlappingVectorRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromFpuRegister(F31);
+ reg_o = Mips64ManagedRegister::FromVectorRegister(W31);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(F31, reg_o.AsOverlappingFpuRegister());
+ EXPECT_EQ(W31, reg.AsOverlappingVectorRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W0);
+ reg_o = Mips64ManagedRegister::FromFpuRegister(F0);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(W0, reg_o.AsOverlappingVectorRegister());
+ EXPECT_EQ(F0, reg.AsOverlappingFpuRegister());
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W4);
+ reg_o = Mips64ManagedRegister::FromFpuRegister(F4);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(W4, reg_o.AsOverlappingVectorRegister());
+ EXPECT_EQ(F4, reg.AsOverlappingFpuRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W16);
+ reg_o = Mips64ManagedRegister::FromFpuRegister(F16);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(W16, reg_o.AsOverlappingVectorRegister());
+ EXPECT_EQ(F16, reg.AsOverlappingFpuRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromVectorRegister(W31);
+ reg_o = Mips64ManagedRegister::FromFpuRegister(F31);
+ EXPECT_TRUE(reg.Overlaps(reg_o));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_EQ(W31, reg_o.AsOverlappingVectorRegister());
+ EXPECT_EQ(F31, reg.AsOverlappingFpuRegister());
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromGpuRegister(ZERO);
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromGpuRegister(A0);
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromGpuRegister(S0);
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+
+ reg = Mips64ManagedRegister::FromGpuRegister(RA);
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(ZERO)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(A0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(S0)));
+ EXPECT_TRUE(reg.Overlaps(Mips64ManagedRegister::FromGpuRegister(RA)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromFpuRegister(F31)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W0)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W4)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W16)));
+ EXPECT_FALSE(reg.Overlaps(Mips64ManagedRegister::FromVectorRegister(W31)));
+}
+
+} // namespace mips64
+} // namespace art
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 4bfc849..fa7e985 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -18,21 +18,21 @@
#include "verifier/verifier_deps.h"
#include "class_linker.h"
-#include "compiler/common_compiler_test.h"
-#include "compiler/dex/verification_results.h"
-#include "compiler/dex/verified_method.h"
-#include "compiler/driver/compiler_options.h"
-#include "compiler/driver/compiler_driver.h"
-#include "compiler/utils/atomic_method_ref_map-inl.h"
+#include "common_compiler_test.h"
#include "compiler_callbacks.h"
+#include "dex/verification_results.h"
+#include "dex/verified_method.h"
#include "dex_file.h"
#include "dex_file_types.h"
+#include "driver/compiler_options.h"
+#include "driver/compiler_driver.h"
#include "handle_scope-inl.h"
#include "verifier/method_verifier-inl.h"
#include "mirror/class_loader.h"
#include "runtime.h"
#include "thread.h"
#include "scoped_thread_state_change-inl.h"
+#include "utils/atomic_method_ref_map-inl.h"
namespace art {
namespace verifier {
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index e80be81..b4ea20b 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -312,13 +312,6 @@
UsageError(" Example: --num-dex-method=%d", CompilerOptions::kDefaultNumDexMethodsThreshold);
UsageError(" Default: %d", CompilerOptions::kDefaultNumDexMethodsThreshold);
UsageError("");
- UsageError(" --inline-depth-limit=<depth-limit>: the depth limit of inlining for fine tuning");
- UsageError(" the compiler. A zero value will disable inlining. Honored only by Optimizing.");
- UsageError(" Has priority over the --compiler-filter option. Intended for ");
- UsageError(" development/experimental use.");
- UsageError(" Example: --inline-depth-limit=%d", CompilerOptions::kDefaultInlineDepthLimit);
- UsageError(" Default: %d", CompilerOptions::kDefaultInlineDepthLimit);
- UsageError("");
UsageError(" --inline-max-code-units=<code-units-count>: the maximum code units that a method");
UsageError(" can have to be considered for inlining. A zero value will disable inlining.");
UsageError(" Honored only by Optimizing. Has priority over the --compiler-filter option.");
@@ -870,22 +863,8 @@
}
}
- // It they are not set, use default values for inlining settings.
- // TODO: We should rethink the compiler filter. We mostly save
- // time here, which is orthogonal to space.
- if (compiler_options_->inline_depth_limit_ == CompilerOptions::kUnsetInlineDepthLimit) {
- compiler_options_->inline_depth_limit_ =
- (compiler_options_->compiler_filter_ == CompilerFilter::kSpace)
- // Implementation of the space filter: limit inlining depth.
- ? CompilerOptions::kSpaceFilterInlineDepthLimit
- : CompilerOptions::kDefaultInlineDepthLimit;
- }
if (compiler_options_->inline_max_code_units_ == CompilerOptions::kUnsetInlineMaxCodeUnits) {
- compiler_options_->inline_max_code_units_ =
- (compiler_options_->compiler_filter_ == CompilerFilter::kSpace)
- // Implementation of the space filter: limit inlining max code units.
- ? CompilerOptions::kSpaceFilterInlineMaxCodeUnits
- : CompilerOptions::kDefaultInlineMaxCodeUnits;
+ compiler_options_->inline_max_code_units_ = CompilerOptions::kDefaultInlineMaxCodeUnits;
}
// Checks are all explicit until we know the architecture.
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index 615bcf9..105610e 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -1700,7 +1700,7 @@
std::unique_ptr<File> new_file;
if (!options_.output_to_memmap_) {
std::string output_location(options_.output_dex_directory_);
- size_t last_slash = dex_file_location.rfind("/");
+ size_t last_slash = dex_file_location.rfind('/');
std::string dex_file_directory = dex_file_location.substr(0, last_slash + 1);
if (output_location == dex_file_directory) {
output_location = dex_file_location + ".new";
diff --git a/profman/profman.cc b/profman/profman.cc
index fdb9a75..dac95b8 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -418,7 +418,7 @@
return true;
}
- bool GetClassNames(std::string profile_file,
+ bool GetClassNames(const std::string& profile_file,
std::vector<std::unique_ptr<const DexFile>>* dex_files,
std::set<std::string>* class_names) {
int fd = open(profile_file.c_str(), O_RDONLY);
@@ -711,7 +711,7 @@
}
std::vector<ProfileMethodInfo::ProfileClassReference> classes(inline_cache_elems.size());
size_t class_it = 0;
- for (const std::string ic_class : inline_cache_elems) {
+ for (const std::string& ic_class : inline_cache_elems) {
if (!FindClass(dex_files, ic_class, &(classes[class_it++]))) {
LOG(ERROR) << "Could not find class: " << ic_class;
return false;
diff --git a/runtime/art_method.h b/runtime/art_method.h
index 2248c3b..8f09cc6 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -691,7 +691,7 @@
// Pointer to JNI function registered to this method, or a function to resolve the JNI function,
// or the profiling data for non-native methods, or an ImtConflictTable, or the
- // single-implementation of an abstract method.
+ // single-implementation of an abstract/interface method.
void* data_;
// Method dispatch from quick compiled code invokes this pointer which may cause bridging into
diff --git a/runtime/base/arena_allocator.cc b/runtime/base/arena_allocator.cc
index 5aede38..e763e43 100644
--- a/runtime/base/arena_allocator.cc
+++ b/runtime/base/arena_allocator.cc
@@ -166,7 +166,7 @@
MEMORY_TOOL_MAKE_NOACCESS(ptr, size);
}
-Arena::Arena() : bytes_allocated_(0), next_(nullptr) {
+Arena::Arena() : bytes_allocated_(0), memory_(nullptr), size_(0), next_(nullptr) {
}
class MallocArena FINAL : public Arena {
diff --git a/runtime/base/histogram-inl.h b/runtime/base/histogram-inl.h
index ca9a694..b28eb72 100644
--- a/runtime/base/histogram-inl.h
+++ b/runtime/base/histogram-inl.h
@@ -48,7 +48,8 @@
: kAdjust(0),
kInitialBucketCount(0),
name_(name),
- max_buckets_(0) {
+ max_buckets_(0),
+ sample_size_(0) {
}
template <class Value>
diff --git a/runtime/cha.cc b/runtime/cha.cc
index eaba01b..7948c29 100644
--- a/runtime/cha.cc
+++ b/runtime/cha.cc
@@ -210,7 +210,7 @@
}
}
-void ClassHierarchyAnalysis::CheckSingleImplementationInfo(
+void ClassHierarchyAnalysis::CheckVirtualMethodSingleImplementationInfo(
Handle<mirror::Class> klass,
ArtMethod* virtual_method,
ArtMethod* method_in_super,
@@ -290,8 +290,9 @@
// A non-abstract method overrides an abstract method.
if (method_in_super->GetSingleImplementation(pointer_size) == nullptr) {
// Abstract method_in_super has no implementation yet.
- // We need to grab cha_lock_ for further checking/updating due to possible
- // races.
+ // We need to grab cha_lock_ since there may be multiple class linking
+ // going on that can check/modify the single-implementation flag/method
+ // of method_in_super.
MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_);
if (!method_in_super->HasSingleImplementation()) {
return;
@@ -362,6 +363,55 @@
}
}
+void ClassHierarchyAnalysis::CheckInterfaceMethodSingleImplementationInfo(
+ Handle<mirror::Class> klass,
+ ArtMethod* interface_method,
+ ArtMethod* implementation_method,
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods,
+ PointerSize pointer_size) {
+ DCHECK(klass->IsInstantiable());
+ DCHECK(interface_method->IsAbstract() || interface_method->IsDefault());
+
+ if (!interface_method->HasSingleImplementation()) {
+ return;
+ }
+
+ if (implementation_method->IsAbstract()) {
+ // An instantiable class doesn't supply an implementation for
+ // interface_method. Invoking the interface method on the class will throw
+ // AbstractMethodError. This is an uncommon case, so we simply treat
+ // interface_method as not having single-implementation.
+ invalidated_single_impl_methods.insert(interface_method);
+ return;
+ }
+
+ // We need to grab cha_lock_ since there may be multiple class linking going
+ // on that can check/modify the single-implementation flag/method of
+ // interface_method.
+ MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_);
+ // Do this check again after we grab cha_lock_.
+ if (!interface_method->HasSingleImplementation()) {
+ return;
+ }
+
+ ArtMethod* single_impl = interface_method->GetSingleImplementation(pointer_size);
+ if (single_impl == nullptr) {
+ // implementation_method becomes the first implementation for
+ // interface_method.
+ interface_method->SetSingleImplementation(implementation_method, pointer_size);
+ // Keep interface_method's single-implementation status.
+ return;
+ }
+ DCHECK(!single_impl->IsAbstract());
+ if (single_impl->GetDeclaringClass() == implementation_method->GetDeclaringClass()) {
+ // Same implementation. Since implementation_method may be a copy of a default
+ // method, we need to check the declaring class for equality.
+ return;
+ }
+ // Another implementation for interface_method.
+ invalidated_single_impl_methods.insert(interface_method);
+}
+
void ClassHierarchyAnalysis::InitSingleImplementationFlag(Handle<mirror::Class> klass,
ArtMethod* method,
PointerSize pointer_size) {
@@ -382,6 +432,7 @@
// Rare case, but we do accept it (such as 800-smali/smali/b_26143249.smali).
// Do not attempt to devirtualize it.
method->SetHasSingleImplementation(false);
+ DCHECK(method->GetSingleImplementation(pointer_size) == nullptr);
} else {
// Abstract method starts with single-implementation flag set and null
// implementation method.
@@ -396,9 +447,15 @@
}
void ClassHierarchyAnalysis::UpdateAfterLoadingOf(Handle<mirror::Class> klass) {
+ PointerSize image_pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
if (klass->IsInterface()) {
+ for (ArtMethod& method : klass->GetDeclaredVirtualMethods(image_pointer_size)) {
+ DCHECK(method.IsAbstract() || method.IsDefault());
+ InitSingleImplementationFlag(klass, &method, image_pointer_size);
+ }
return;
}
+
mirror::Class* super_class = klass->GetSuperClass();
if (super_class == nullptr) {
return;
@@ -408,7 +465,6 @@
// is invalidated by linking `klass`.
std::unordered_set<ArtMethod*> invalidated_single_impl_methods;
- PointerSize image_pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
// Do an entry-by-entry comparison of vtable contents with super's vtable.
for (int32_t i = 0; i < super_class->GetVTableLength(); ++i) {
ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size);
@@ -418,33 +474,59 @@
if (method->IsAbstract() && klass->IsInstantiable()) {
// An instantiable class that inherits an abstract method is treated as
// supplying an implementation that throws AbstractMethodError.
- CheckSingleImplementationInfo(klass,
- method,
- method_in_super,
- invalidated_single_impl_methods,
- image_pointer_size);
+ CheckVirtualMethodSingleImplementationInfo(klass,
+ method,
+ method_in_super,
+ invalidated_single_impl_methods,
+ image_pointer_size);
}
continue;
}
InitSingleImplementationFlag(klass, method, image_pointer_size);
- CheckSingleImplementationInfo(klass,
- method,
- method_in_super,
- invalidated_single_impl_methods,
- image_pointer_size);
+ CheckVirtualMethodSingleImplementationInfo(klass,
+ method,
+ method_in_super,
+ invalidated_single_impl_methods,
+ image_pointer_size);
}
-
// For new virtual methods that don't override.
for (int32_t i = super_class->GetVTableLength(); i < klass->GetVTableLength(); ++i) {
ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size);
InitSingleImplementationFlag(klass, method, image_pointer_size);
}
- Runtime* const runtime = Runtime::Current();
+ if (klass->IsInstantiable()) {
+ auto* iftable = klass->GetIfTable();
+ const size_t ifcount = klass->GetIfTableCount();
+ for (size_t i = 0; i < ifcount; ++i) {
+ mirror::Class* interface = iftable->GetInterface(i);
+ for (size_t j = 0, count = iftable->GetMethodArrayCount(i); j < count; ++j) {
+ ArtMethod* interface_method = interface->GetVirtualMethod(j, image_pointer_size);
+ mirror::PointerArray* method_array = iftable->GetMethodArray(i);
+ ArtMethod* implementation_method =
+ method_array->GetElementPtrSize<ArtMethod*>(j, image_pointer_size);
+ DCHECK(implementation_method != nullptr) << klass->PrettyClass();
+ CheckInterfaceMethodSingleImplementationInfo(klass,
+ interface_method,
+ implementation_method,
+ invalidated_single_impl_methods,
+ image_pointer_size);
+ }
+ }
+ }
+
+ InvalidateSingleImplementationMethods(invalidated_single_impl_methods);
+}
+
+void ClassHierarchyAnalysis::InvalidateSingleImplementationMethods(
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods) {
if (!invalidated_single_impl_methods.empty()) {
+ Runtime* const runtime = Runtime::Current();
Thread *self = Thread::Current();
// Method headers for compiled code to be invalidated.
std::unordered_set<OatQuickMethodHeader*> dependent_method_headers;
+ PointerSize image_pointer_size =
+ Runtime::Current()->GetClassLinker()->GetImagePointerSize();
{
// We do this under cha_lock_. Committing code also grabs this lock to
diff --git a/runtime/cha.h b/runtime/cha.h
index a56a752..99c49d2 100644
--- a/runtime/cha.h
+++ b/runtime/cha.h
@@ -117,11 +117,13 @@
PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Check/update single-implementation info when one virtual method
+ // overrides another.
// `virtual_method` in `klass` overrides `method_in_super`.
- // This will invalidate some assumptions on single-implementation.
+ // This may invalidate some assumptions on single-implementation.
// Append methods that should have their single-implementation flag invalidated
// to `invalidated_single_impl_methods`.
- void CheckSingleImplementationInfo(
+ void CheckVirtualMethodSingleImplementationInfo(
Handle<mirror::Class> klass,
ArtMethod* virtual_method,
ArtMethod* method_in_super,
@@ -129,6 +131,23 @@
PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Check/update single-implementation info when one method
+ // implements an interface method.
+ // `implementation_method` in `klass` implements `interface_method`.
+ // Append `interface_method` to `invalidated_single_impl_methods`
+ // if `interface_method` gets a new implementation.
+ void CheckInterfaceMethodSingleImplementationInfo(
+ Handle<mirror::Class> klass,
+ ArtMethod* interface_method,
+ ArtMethod* implementation_method,
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods,
+ PointerSize pointer_size)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ void InvalidateSingleImplementationMethods(
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// For all methods in vtable slot at `verify_index` of `verify_class` and its
// superclasses, single-implementation status should be false, except if the
// method is `excluded_method`.
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 8162a82..f936db9 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -3505,13 +3505,12 @@
return dex_cache;
}
// Failure, dump diagnostic and abort.
- std::string location(dex_file.GetLocation());
for (const DexCacheData& data : dex_caches_) {
if (DecodeDexCache(self, data) != nullptr) {
- LOG(ERROR) << "Registered dex file " << data.dex_file->GetLocation();
+ LOG(FATAL_WITHOUT_ABORT) << "Registered dex file " << data.dex_file->GetLocation();
}
}
- LOG(FATAL) << "Failed to find DexCache for DexFile " << location;
+ LOG(FATAL) << "Failed to find DexCache for DexFile " << dex_file.GetLocation();
UNREACHABLE();
}
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 9f04e59..b421810 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -618,7 +618,7 @@
ClassExtOffsets() : CheckOffsets<mirror::ClassExt>(false, "Ldalvik/system/ClassExt;") {
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_dex_caches_), "obsoleteDexCaches");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_methods_), "obsoleteMethods");
- addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_file_bytes_), "originalDexFile");
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_file_), "originalDexFile");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, verify_error_), "verifyError");
}
};
diff --git a/runtime/fault_handler.cc b/runtime/fault_handler.cc
index 64128cc..4220250 100644
--- a/runtime/fault_handler.cc
+++ b/runtime/fault_handler.cc
@@ -38,8 +38,8 @@
}
// Signal handler called on SIGSEGV.
-static void art_fault_handler(int sig, siginfo_t* info, void* context) {
- fault_manager.HandleFault(sig, info, context);
+static bool art_fault_handler(int sig, siginfo_t* info, void* context) {
+ return fault_manager.HandleFault(sig, info, context);
}
FaultManager::FaultManager() : initialized_(false) {
@@ -49,43 +49,15 @@
FaultManager::~FaultManager() {
}
-static void SetUpArtAction(struct sigaction* action) {
- action->sa_sigaction = art_fault_handler;
- sigemptyset(&action->sa_mask);
- action->sa_flags = SA_SIGINFO | SA_ONSTACK;
-#if !defined(__APPLE__) && !defined(__mips__)
- action->sa_restorer = nullptr;
-#endif
-}
-
-void FaultManager::EnsureArtActionInFrontOfSignalChain() {
- if (initialized_) {
- struct sigaction action;
- SetUpArtAction(&action);
- EnsureFrontOfChain(SIGSEGV, &action);
- } else {
- LOG(WARNING) << "Can't call " << __FUNCTION__ << " due to unitialized fault manager";
- }
-}
-
void FaultManager::Init() {
CHECK(!initialized_);
- struct sigaction action;
- SetUpArtAction(&action);
-
- // Set our signal handler now.
- int e = sigaction(SIGSEGV, &action, &oldaction_);
- if (e != 0) {
- VLOG(signals) << "Failed to claim SEGV: " << strerror(errno);
- }
- // Make sure our signal handler is called before any user handlers.
- ClaimSignalChain(SIGSEGV, &oldaction_);
+ AddSpecialSignalHandlerFn(SIGSEGV, art_fault_handler);
initialized_ = true;
}
void FaultManager::Release() {
if (initialized_) {
- UnclaimSignalChain(SIGSEGV);
+ RemoveSpecialSignalHandlerFn(SIGSEGV, art_fault_handler);
initialized_ = false;
}
}
@@ -118,93 +90,36 @@
return false;
}
-class ScopedSignalUnblocker {
- public:
- explicit ScopedSignalUnblocker(const std::initializer_list<int>& signals) {
- sigset_t new_mask;
- sigemptyset(&new_mask);
- for (int signal : signals) {
- sigaddset(&new_mask, signal);
- }
- if (sigprocmask(SIG_UNBLOCK, &new_mask, &previous_mask_) != 0) {
- PLOG(FATAL) << "failed to unblock signals";
- }
- }
-
- ~ScopedSignalUnblocker() {
- if (sigprocmask(SIG_SETMASK, &previous_mask_, nullptr) != 0) {
- PLOG(FATAL) << "failed to unblock signals";
- }
- }
-
- private:
- sigset_t previous_mask_;
-};
-
-class ScopedHandlingSignalSetter {
- public:
- explicit ScopedHandlingSignalSetter(Thread* thread) : thread_(thread) {
- CHECK(!thread->HandlingSignal());
- thread_->SetHandlingSignal(true);
- }
-
- ~ScopedHandlingSignalSetter() {
- CHECK(thread_->HandlingSignal());
- thread_->SetHandlingSignal(false);
- }
-
- private:
- Thread* thread_;
-};
-
-void FaultManager::HandleFault(int sig, siginfo_t* info, void* context) {
- // BE CAREFUL ALLOCATING HERE INCLUDING USING LOG(...)
- //
- // If malloc calls abort, it will be holding its lock.
- // If the handler tries to call malloc, it will deadlock.
-
- // Use a thread local field to track whether we're recursing, and fall back.
- // (e.g.. if one of our handlers crashed)
- Thread* thread = Thread::Current();
-
- if (thread != nullptr && !thread->HandlingSignal()) {
- // Unblock some signals and set thread->handling_signal_ to true,
- // so that we can catch crashes in our signal handler.
- ScopedHandlingSignalSetter setter(thread);
- ScopedSignalUnblocker unblocker { SIGABRT, SIGBUS, SIGSEGV }; // NOLINT
-
- VLOG(signals) << "Handling fault";
+bool FaultManager::HandleFault(int sig, siginfo_t* info, void* context) {
+ VLOG(signals) << "Handling fault";
#ifdef TEST_NESTED_SIGNAL
- // Simulate a crash in a handler.
- raise(SIGSEGV);
+ // Simulate a crash in a handler.
+ raise(SIGSEGV);
#endif
- if (IsInGeneratedCode(info, context, true)) {
- VLOG(signals) << "in generated code, looking for handler";
- for (const auto& handler : generated_code_handlers_) {
- VLOG(signals) << "invoking Action on handler " << handler;
- if (handler->Action(sig, info, context)) {
- // We have handled a signal so it's time to return from the
- // signal handler to the appropriate place.
- return;
- }
+ if (IsInGeneratedCode(info, context, true)) {
+ VLOG(signals) << "in generated code, looking for handler";
+ for (const auto& handler : generated_code_handlers_) {
+ VLOG(signals) << "invoking Action on handler " << handler;
+ if (handler->Action(sig, info, context)) {
+ // We have handled a signal so it's time to return from the
+ // signal handler to the appropriate place.
+ return true;
}
+ }
- // We hit a signal we didn't handle. This might be something for which
- // we can give more information about so call all registered handlers to
- // see if it is.
- if (HandleFaultByOtherHandlers(sig, info, context)) {
- return;
- }
+ // We hit a signal we didn't handle. This might be something for which
+ // we can give more information about so call all registered handlers to
+ // see if it is.
+ if (HandleFaultByOtherHandlers(sig, info, context)) {
+ return true;
}
}
// Set a breakpoint in this function to catch unhandled signals.
art_sigsegv_fault();
-
- // Pass this on to the next handler in the chain, or the default if none.
- InvokeUserSignalHandler(sig, info, context);
+ return false;
}
void FaultManager::AddHandler(FaultHandler* handler, bool generated_code) {
diff --git a/runtime/fault_handler.h b/runtime/fault_handler.h
index ce59ba7..d56cf17 100644
--- a/runtime/fault_handler.h
+++ b/runtime/fault_handler.h
@@ -42,9 +42,9 @@
// Unclaim signals and delete registered handlers.
void Shutdown();
- void EnsureArtActionInFrontOfSignalChain();
- void HandleFault(int sig, siginfo_t* info, void* context);
+ // Try to handle a fault, returns true if successful.
+ bool HandleFault(int sig, siginfo_t* info, void* context);
// Added handlers are owned by the fault handler and will be freed on Shutdown().
void AddHandler(FaultHandler* handler, bool generated_code);
diff --git a/runtime/gc/allocator/rosalloc.h b/runtime/gc/allocator/rosalloc.h
index 1fa2d1a..562fc75 100644
--- a/runtime/gc/allocator/rosalloc.h
+++ b/runtime/gc/allocator/rosalloc.h
@@ -141,7 +141,7 @@
template<bool kUseTail = true>
class SlotFreeList {
public:
- SlotFreeList() : head_(0U), tail_(0), size_(0) {}
+ SlotFreeList() : head_(0U), tail_(0), size_(0), padding_(0) {}
Slot* Head() const {
return reinterpret_cast<Slot*>(head_);
}
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index d2ab41d..24ba52f 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -72,12 +72,19 @@
rb_mark_bit_stack_full_(false),
mark_stack_lock_("concurrent copying mark stack lock", kMarkSweepMarkStackLock),
thread_running_gc_(nullptr),
- is_marking_(false), is_active_(false), is_asserting_to_space_invariant_(false),
+ is_marking_(false),
+ is_active_(false),
+ is_asserting_to_space_invariant_(false),
region_space_bitmap_(nullptr),
- heap_mark_bitmap_(nullptr), live_stack_freeze_size_(0), mark_stack_mode_(kMarkStackModeOff),
+ heap_mark_bitmap_(nullptr),
+ live_stack_freeze_size_(0),
+ from_space_num_objects_at_first_pause_(0),
+ from_space_num_bytes_at_first_pause_(0),
+ mark_stack_mode_(kMarkStackModeOff),
weak_ref_access_enabled_(true),
skipped_blocks_lock_("concurrent copying bytes blocks lock", kMarkSweepMarkStackLock),
measure_read_barrier_slow_path_(measure_read_barrier_slow_path),
+ mark_from_read_barrier_measurements_(false),
rb_slow_path_ns_(0),
rb_slow_path_count_(0),
rb_slow_path_count_gc_(0),
@@ -87,6 +94,7 @@
rb_slow_path_count_gc_total_(0),
rb_table_(heap_->GetReadBarrierTable()),
force_evacuate_all_(false),
+ gc_grays_immune_objects_(false),
immune_gray_stack_lock_("concurrent copying immune gray stack lock",
kMarkSweepMarkStackLock) {
static_assert(space::RegionSpace::kRegionSize == accounting::ReadBarrierTable::kRegionSize,
diff --git a/runtime/gc/collector/mark_compact.cc b/runtime/gc/collector/mark_compact.cc
index 0039388..c61f69d 100644
--- a/runtime/gc/collector/mark_compact.cc
+++ b/runtime/gc/collector/mark_compact.cc
@@ -52,8 +52,12 @@
MarkCompact::MarkCompact(Heap* heap, const std::string& name_prefix)
: GarbageCollector(heap, name_prefix + (name_prefix.empty() ? "" : " ") + "mark compact"),
+ mark_stack_(nullptr),
space_(nullptr),
+ mark_bitmap_(nullptr),
collector_name_(name_),
+ bump_pointer_(nullptr),
+ live_objects_in_space_(0),
updating_references_(false) {}
void MarkCompact::RunPhases() {
diff --git a/runtime/gc/space/large_object_space.cc b/runtime/gc/space/large_object_space.cc
index 4c6b5bf..3988073 100644
--- a/runtime/gc/space/large_object_space.cc
+++ b/runtime/gc/space/large_object_space.cc
@@ -16,13 +16,12 @@
#include "large_object_space.h"
-#include <valgrind.h>
#include <memory>
-#include <memcheck/memcheck.h>
#include "gc/accounting/heap_bitmap-inl.h"
#include "gc/accounting/space_bitmap-inl.h"
#include "base/logging.h"
+#include "base/memory_tool.h"
#include "base/mutex-inl.h"
#include "base/stl_util.h"
#include "image.h"
diff --git a/runtime/interpreter/interpreter.cc b/runtime/interpreter/interpreter.cc
index 1b3d339..67e949f 100644
--- a/runtime/interpreter/interpreter.cc
+++ b/runtime/interpreter/interpreter.cc
@@ -232,12 +232,6 @@
kSwitchImplKind, // Switch-based interpreter implementation.
kMterpImplKind // Assembly interpreter
};
-static std::ostream& operator<<(std::ostream& os, const InterpreterImplKind& rhs) {
- os << ((rhs == kSwitchImplKind)
- ? "Switch-based interpreter"
- : "Asm interpreter");
- return os;
-}
static constexpr InterpreterImplKind kInterpreterImplKind = kMterpImplKind;
diff --git a/runtime/interpreter/interpreter_intrinsics.cc b/runtime/interpreter/interpreter_intrinsics.cc
index 0ae7307..869d430 100644
--- a/runtime/interpreter/interpreter_intrinsics.cc
+++ b/runtime/interpreter/interpreter_intrinsics.cc
@@ -14,9 +14,12 @@
* limitations under the License.
*/
-#include "interpreter/interpreter_common.h"
#include "interpreter/interpreter_intrinsics.h"
+#include "compiler/intrinsics_enum.h"
+#include "dex_instruction.h"
+#include "interpreter/interpreter_common.h"
+
namespace art {
namespace interpreter {
diff --git a/runtime/interpreter/interpreter_intrinsics.h b/runtime/interpreter/interpreter_intrinsics.h
index ae45679..2a23002 100644
--- a/runtime/interpreter/interpreter_intrinsics.h
+++ b/runtime/interpreter/interpreter_intrinsics.h
@@ -17,10 +17,14 @@
#ifndef ART_RUNTIME_INTERPRETER_INTERPRETER_INTRINSICS_H_
#define ART_RUNTIME_INTERPRETER_INTERPRETER_INTRINSICS_H_
-#include "compiler/intrinsics_enum.h"
-#include "dex_instruction.h"
+#include "jvalue.h"
namespace art {
+
+class ArtMethod;
+class Instruction;
+class ShadowFrame;
+
namespace interpreter {
// Invokes to methods identified as intrinics are routed here. If there is
diff --git a/runtime/java_vm_ext.cc b/runtime/java_vm_ext.cc
index a341cdb..b93b8f2 100644
--- a/runtime/java_vm_ext.cc
+++ b/runtime/java_vm_ext.cc
@@ -39,6 +39,7 @@
#include "runtime_options.h"
#include "ScopedLocalRef.h"
#include "scoped_thread_state_change-inl.h"
+#include "sigchain.h"
#include "thread-inl.h"
#include "thread_list.h"
@@ -900,7 +901,8 @@
int version = (*jni_on_load)(this, nullptr);
if (runtime_->GetTargetSdkVersion() != 0 && runtime_->GetTargetSdkVersion() <= 21) {
- fault_manager.EnsureArtActionInFrontOfSignalChain();
+ // Make sure that sigchain owns SIGSEGV.
+ EnsureFrontOfChain(SIGSEGV);
}
self->SetClassLoaderOverride(old_class_loader.get());
diff --git a/runtime/jit/jit.h b/runtime/jit/jit.h
index 5da1ea1..4f5bebf 100644
--- a/runtime/jit/jit.h
+++ b/runtime/jit/jit.h
@@ -279,6 +279,10 @@
code_cache_initial_capacity_(0),
code_cache_max_capacity_(0),
compile_threshold_(0),
+ warmup_threshold_(0),
+ osr_threshold_(0),
+ priority_thread_weight_(0),
+ invoke_transition_weight_(0),
dump_info_on_shutdown_(false) {}
DISALLOW_COPY_AND_ASSIGN(JitOptions);
diff --git a/runtime/jit/jit_code_cache.cc b/runtime/jit/jit_code_cache.cc
index fc41f94..e9a5ae5 100644
--- a/runtime/jit/jit_code_cache.cc
+++ b/runtime/jit/jit_code_cache.cc
@@ -1366,7 +1366,10 @@
MutexLock mu(self, lock_);
ProfilingInfo* info = method->GetProfilingInfo(kRuntimePointerSize);
if (info != nullptr) {
- info->IncrementInlineUse();
+ if (!info->IncrementInlineUse()) {
+ // Overflow of inlining uses, just bail.
+ return nullptr;
+ }
}
return info;
}
diff --git a/runtime/jit/profile_compilation_info.cc b/runtime/jit/profile_compilation_info.cc
index b23a863..a2c459c 100644
--- a/runtime/jit/profile_compilation_info.cc
+++ b/runtime/jit/profile_compilation_info.cc
@@ -498,13 +498,13 @@
return true;
}
-#define READ_UINT(type, buffer, dest, error) \
- do { \
- if (!buffer.ReadUintAndAdvance<type>(&dest)) { \
- *error = "Could not read "#dest; \
- return false; \
- } \
- } \
+#define READ_UINT(type, buffer, dest, error) \
+ do { \
+ if (!(buffer).ReadUintAndAdvance<type>(&(dest))) { \
+ *(error) = "Could not read "#dest; \
+ return false; \
+ } \
+ } \
while (false)
bool ProfileCompilationInfo::ReadInlineCache(SafeBuffer& buffer,
@@ -1027,7 +1027,7 @@
}
}
os << "\n\tmethods: ";
- for (const auto method_it : dex_data.method_map) {
+ for (const auto& method_it : dex_data.method_map) {
if (dex_file != nullptr) {
os << "\n\t\t" << dex_file->PrettyMethod(method_it.first, true);
} else {
diff --git a/runtime/jit/profile_compilation_info.h b/runtime/jit/profile_compilation_info.h
index 6ad528c..451d53e 100644
--- a/runtime/jit/profile_compilation_info.h
+++ b/runtime/jit/profile_compilation_info.h
@@ -86,7 +86,7 @@
// A dex location together with its checksum.
struct DexReference {
- DexReference() {}
+ DexReference() : dex_checksum(0) {}
DexReference(const std::string& location, uint32_t checksum)
: dex_location(location), dex_checksum(checksum) {}
diff --git a/runtime/jit/profiling_info.h b/runtime/jit/profiling_info.h
index f42a8da..d6881aa 100644
--- a/runtime/jit/profiling_info.h
+++ b/runtime/jit/profiling_info.h
@@ -108,9 +108,15 @@
}
}
- void IncrementInlineUse() {
- DCHECK_NE(current_inline_uses_, std::numeric_limits<uint16_t>::max());
+ // Increments the number of times this method is currently being inlined.
+ // Returns whether it was successful, that is it could increment without
+ // overflowing.
+ bool IncrementInlineUse() {
+ if (current_inline_uses_ == std::numeric_limits<uint16_t>::max()) {
+ return false;
+ }
current_inline_uses_++;
+ return true;
}
void DecrementInlineUse() {
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index 5dc3aca..94e4b88 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -117,9 +117,9 @@
}
}
-void ClassExt::SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) {
+void ClassExt::SetOriginalDexFile(ObjPtr<Object> bytes) {
DCHECK(!Runtime::Current()->IsActiveTransaction());
- SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_), bytes);
+ SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_), bytes);
}
void ClassExt::SetClass(ObjPtr<Class> dalvik_system_ClassExt) {
diff --git a/runtime/mirror/class_ext.h b/runtime/mirror/class_ext.h
index fac955a..708665d 100644
--- a/runtime/mirror/class_ext.h
+++ b/runtime/mirror/class_ext.h
@@ -60,11 +60,11 @@
OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_));
}
- ByteArray* GetOriginalDexFileBytes() REQUIRES_SHARED(Locks::mutator_lock_) {
- return GetFieldObject<ByteArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_));
+ Object* GetOriginalDexFile() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<Object>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_));
}
- void SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) REQUIRES_SHARED(Locks::mutator_lock_);
+ void SetOriginalDexFile(ObjPtr<Object> bytes) REQUIRES_SHARED(Locks::mutator_lock_);
void SetObsoleteArrays(ObjPtr<PointerArray> methods, ObjPtr<ObjectArray<DexCache>> dex_caches)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -89,7 +89,7 @@
HeapReference<PointerArray> obsolete_methods_;
- HeapReference<ByteArray> original_dex_file_bytes_;
+ HeapReference<Object> original_dex_file_;
// The saved verification error of this class.
HeapReference<Object> verify_error_;
diff --git a/runtime/mirror/dex_cache.h b/runtime/mirror/dex_cache.h
index 78b2e15..cf570b8 100644
--- a/runtime/mirror/dex_cache.h
+++ b/runtime/mirror/dex_cache.h
@@ -65,7 +65,7 @@
DexCachePair(ObjPtr<T> object, uint32_t index)
: object(object),
index(index) {}
- DexCachePair() = default;
+ DexCachePair() : index(0) {}
DexCachePair(const DexCachePair<T>&) = default;
DexCachePair& operator=(const DexCachePair<T>&) = default;
diff --git a/runtime/monitor.h b/runtime/monitor.h
index 1fa4682..e80d31c 100644
--- a/runtime/monitor.h
+++ b/runtime/monitor.h
@@ -354,7 +354,7 @@
// For use only by the JDWP implementation.
class MonitorInfo {
public:
- MonitorInfo() = default;
+ MonitorInfo() : owner_(nullptr), entry_count_(0) {}
MonitorInfo(const MonitorInfo&) = default;
MonitorInfo& operator=(const MonitorInfo&) = default;
explicit MonitorInfo(mirror::Object* o) REQUIRES(Locks::mutator_lock_);
diff --git a/runtime/native_bridge_art_interface.cc b/runtime/native_bridge_art_interface.cc
index c58854b..d77cfa1 100644
--- a/runtime/native_bridge_art_interface.cc
+++ b/runtime/native_bridge_art_interface.cc
@@ -118,7 +118,7 @@
for (int signal = 0; signal < _NSIG; ++signal) {
android::NativeBridgeSignalHandlerFn fn = android::NativeBridgeGetSignalHandler(signal);
if (fn != nullptr) {
- SetSpecialSignalHandlerFn(signal, fn);
+ AddSpecialSignalHandlerFn(signal, fn);
}
}
#endif
diff --git a/runtime/nth_caller_visitor.h b/runtime/nth_caller_visitor.h
index f72a853..71c6a82 100644
--- a/runtime/nth_caller_visitor.h
+++ b/runtime/nth_caller_visitor.h
@@ -31,7 +31,8 @@
n(n_in),
include_runtime_and_upcalls_(include_runtime_and_upcalls),
count(0),
- caller(nullptr) {}
+ caller(nullptr),
+ caller_pc(0) {}
bool VisitFrame() REQUIRES_SHARED(Locks::mutator_lock_) {
ArtMethod* m = GetMethod();
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index 3396ce0..db6f8ee 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -640,15 +640,8 @@
std::string dir = location.substr(0, pos+1);
dir += "oat/" + std::string(GetInstructionSetString(isa));
- // Find the file portion of the dex location.
- std::string file;
- if (pos == std::string::npos) {
- file = location;
- } else {
- file = location.substr(pos+1);
- }
-
// Get the base part of the file without the extension.
+ std::string file = location.substr(pos+1);
pos = file.rfind('.');
if (pos == std::string::npos) {
*error_msg = "Dex location " + location + " has no extension.";
diff --git a/runtime/oat_file_assistant.h b/runtime/oat_file_assistant.h
index d61e994..b84e711 100644
--- a/runtime/oat_file_assistant.h
+++ b/runtime/oat_file_assistant.h
@@ -369,7 +369,7 @@
std::unique_ptr<OatFile> file_;
bool status_attempted_ = false;
- OatStatus status_;
+ OatStatus status_ = OatStatus::kOatCannotOpen;
// For debugging only.
// If this flag is set, the file has been released to the user and the
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 5401e5c..448e1ed 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -79,20 +79,26 @@
class JvmtiFunctions {
private:
- static bool IsValidEnv(jvmtiEnv* env) {
- return env != nullptr;
+ static jvmtiError getEnvironmentError(jvmtiEnv* env) {
+ if (env == nullptr) {
+ return ERR(INVALID_ENVIRONMENT);
+ } else if (art::Thread::Current() == nullptr) {
+ return ERR(UNATTACHED_THREAD);
+ } else {
+ return OK;
+ }
}
-#define ENSURE_VALID_ENV(env) \
- do { \
- if (!IsValidEnv(env)) { \
- return ERR(INVALID_ENVIRONMENT); \
- } \
+#define ENSURE_VALID_ENV(env) \
+ do { \
+ jvmtiError ensure_valid_env_ ## __LINE__ = getEnvironmentError(env); \
+ if (ensure_valid_env_ ## __LINE__ != OK) { \
+ return ensure_valid_env_ ## __LINE__ ; \
+ } \
} while (false)
#define ENSURE_HAS_CAP(env, cap) \
do { \
- ENSURE_VALID_ENV(env); \
if (ArtJvmTiEnv::AsArtJvmTiEnv(env)->capabilities.cap != 1) { \
return ERR(MUST_POSSESS_CAPABILITY); \
} \
@@ -121,18 +127,22 @@
}
static jvmtiError GetThreadState(jvmtiEnv* env, jthread thread, jint* thread_state_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::GetThreadState(env, thread, thread_state_ptr);
}
static jvmtiError GetCurrentThread(jvmtiEnv* env, jthread* thread_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::GetCurrentThread(env, thread_ptr);
}
static jvmtiError GetAllThreads(jvmtiEnv* env, jint* threads_count_ptr, jthread** threads_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::GetAllThreads(env, threads_count_ptr, threads_ptr);
}
static jvmtiError SuspendThread(jvmtiEnv* env, jthread thread ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_suspend);
return ERR(NOT_IMPLEMENTED);
}
@@ -141,11 +151,13 @@
jint request_count ATTRIBUTE_UNUSED,
const jthread* request_list ATTRIBUTE_UNUSED,
jvmtiError* results ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_suspend);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError ResumeThread(jvmtiEnv* env, jthread thread ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_suspend);
return ERR(NOT_IMPLEMENTED);
}
@@ -154,6 +166,7 @@
jint request_count ATTRIBUTE_UNUSED,
const jthread* request_list ATTRIBUTE_UNUSED,
jvmtiError* results ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_suspend);
return ERR(NOT_IMPLEMENTED);
}
@@ -161,16 +174,19 @@
static jvmtiError StopThread(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jobject exception ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_signal_thread);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError InterruptThread(jvmtiEnv* env, jthread thread ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_signal_thread);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetThreadInfo(jvmtiEnv* env, jthread thread, jvmtiThreadInfo* info_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::GetThreadInfo(env, thread, info_ptr);
}
@@ -178,6 +194,7 @@
jthread thread ATTRIBUTE_UNUSED,
jint* owned_monitor_count_ptr ATTRIBUTE_UNUSED,
jobject** owned_monitors_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_owned_monitor_info);
return ERR(NOT_IMPLEMENTED);
}
@@ -187,6 +204,7 @@
jthread thread ATTRIBUTE_UNUSED,
jint* monitor_info_count_ptr ATTRIBUTE_UNUSED,
jvmtiMonitorStackDepthInfo** monitor_info_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_owned_monitor_stack_depth_info);
return ERR(NOT_IMPLEMENTED);
}
@@ -194,6 +212,7 @@
static jvmtiError GetCurrentContendedMonitor(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jobject* monitor_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_current_contended_monitor);
return ERR(NOT_IMPLEMENTED);
}
@@ -203,26 +222,31 @@
jvmtiStartFunction proc,
const void* arg,
jint priority) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::RunAgentThread(env, thread, proc, arg, priority);
}
static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::SetThreadLocalStorage(env, thread, data);
}
static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadUtil::GetThreadLocalStorage(env, thread, data_ptr);
}
static jvmtiError GetTopThreadGroups(jvmtiEnv* env,
jint* group_count_ptr,
jthreadGroup** groups_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadGroupUtil::GetTopThreadGroups(env, group_count_ptr, groups_ptr);
}
static jvmtiError GetThreadGroupInfo(jvmtiEnv* env,
jthreadGroup group,
jvmtiThreadGroupInfo* info_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadGroupUtil::GetThreadGroupInfo(env, group, info_ptr);
}
@@ -232,6 +256,7 @@
jthread** threads_ptr,
jint* group_count_ptr,
jthreadGroup** groups_ptr) {
+ ENSURE_VALID_ENV(env);
return ThreadGroupUtil::GetThreadGroupChildren(env,
group,
thread_count_ptr,
@@ -246,6 +271,7 @@
jint max_frame_count,
jvmtiFrameInfo* frame_buffer,
jint* count_ptr) {
+ ENSURE_VALID_ENV(env);
return StackUtil::GetStackTrace(env,
thread,
start_depth,
@@ -258,6 +284,7 @@
jint max_frame_count,
jvmtiStackInfo** stack_info_ptr,
jint* thread_count_ptr) {
+ ENSURE_VALID_ENV(env);
return StackUtil::GetAllStackTraces(env, max_frame_count, stack_info_ptr, thread_count_ptr);
}
@@ -266,6 +293,7 @@
const jthread* thread_list,
jint max_frame_count,
jvmtiStackInfo** stack_info_ptr) {
+ ENSURE_VALID_ENV(env);
return StackUtil::GetThreadListStackTraces(env,
thread_count,
thread_list,
@@ -274,10 +302,12 @@
}
static jvmtiError GetFrameCount(jvmtiEnv* env, jthread thread, jint* count_ptr) {
+ ENSURE_VALID_ENV(env);
return StackUtil::GetFrameCount(env, thread, count_ptr);
}
static jvmtiError PopFrame(jvmtiEnv* env, jthread thread ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_pop_frame);
return ERR(NOT_IMPLEMENTED);
}
@@ -287,12 +317,14 @@
jint depth,
jmethodID* method_ptr,
jlocation* location_ptr) {
+ ENSURE_VALID_ENV(env);
return StackUtil::GetFrameLocation(env, thread, depth, method_ptr, location_ptr);
}
static jvmtiError NotifyFramePop(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jint depth ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_frame_pop_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -300,6 +332,7 @@
static jvmtiError ForceEarlyReturnObject(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jobject value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
@@ -307,6 +340,7 @@
static jvmtiError ForceEarlyReturnInt(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jint value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
@@ -314,6 +348,7 @@
static jvmtiError ForceEarlyReturnLong(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jlong value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
@@ -321,6 +356,7 @@
static jvmtiError ForceEarlyReturnFloat(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jfloat value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
@@ -328,11 +364,13 @@
static jvmtiError ForceEarlyReturnDouble(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jdouble value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError ForceEarlyReturnVoid(jvmtiEnv* env, jthread thread ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_force_early_return);
return ERR(NOT_IMPLEMENTED);
}
@@ -343,6 +381,7 @@
jobject initial_object,
const jvmtiHeapCallbacks* callbacks,
const void* user_data) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
HeapUtil heap_util(ArtJvmTiEnv::AsArtJvmTiEnv(env)->object_tag_table.get());
return heap_util.FollowReferences(env,
@@ -358,12 +397,14 @@
jclass klass,
const jvmtiHeapCallbacks* callbacks,
const void* user_data) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
HeapUtil heap_util(ArtJvmTiEnv::AsArtJvmTiEnv(env)->object_tag_table.get());
return heap_util.IterateThroughHeap(env, heap_filter, klass, callbacks, user_data);
}
static jvmtiError GetTag(jvmtiEnv* env, jobject object, jlong* tag_ptr) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
JNIEnv* jni_env = GetJniEnv(env);
@@ -381,6 +422,7 @@
}
static jvmtiError SetTag(jvmtiEnv* env, jobject object, jlong tag) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
if (object == nullptr) {
@@ -405,6 +447,7 @@
jint* count_ptr,
jobject** object_result_ptr,
jlong** tag_result_ptr) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
JNIEnv* jni_env = GetJniEnv(env);
@@ -422,6 +465,7 @@
}
static jvmtiError ForceGarbageCollection(jvmtiEnv* env) {
+ ENSURE_VALID_ENV(env);
return HeapUtil::ForceGarbageCollection(env);
}
@@ -430,6 +474,7 @@
jobject object ATTRIBUTE_UNUSED,
jvmtiObjectReferenceCallback object_reference_callback ATTRIBUTE_UNUSED,
const void* user_data ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
return ERR(NOT_IMPLEMENTED);
}
@@ -440,6 +485,7 @@
jvmtiStackReferenceCallback stack_ref_callback ATTRIBUTE_UNUSED,
jvmtiObjectReferenceCallback object_ref_callback ATTRIBUTE_UNUSED,
const void* user_data ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
return ERR(NOT_IMPLEMENTED);
}
@@ -448,6 +494,7 @@
jvmtiHeapObjectFilter object_filter ATTRIBUTE_UNUSED,
jvmtiHeapObjectCallback heap_object_callback ATTRIBUTE_UNUSED,
const void* user_data ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
return ERR(NOT_IMPLEMENTED);
}
@@ -458,6 +505,7 @@
jvmtiHeapObjectFilter object_filter ATTRIBUTE_UNUSED,
jvmtiHeapObjectCallback heap_object_callback ATTRIBUTE_UNUSED,
const void* user_data ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_tag_objects);
return ERR(NOT_IMPLEMENTED);
}
@@ -467,6 +515,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jobject* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -475,6 +524,7 @@
jthread thread ATTRIBUTE_UNUSED,
jint depth ATTRIBUTE_UNUSED,
jobject* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -484,6 +534,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jint* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -493,6 +544,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jlong* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -502,6 +554,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jfloat* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -511,6 +564,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jdouble* value_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -520,6 +574,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jobject value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -529,6 +584,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jint value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -538,6 +594,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jlong value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -547,6 +604,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jfloat value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -556,6 +614,7 @@
jint depth ATTRIBUTE_UNUSED,
jint slot ATTRIBUTE_UNUSED,
jdouble value ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -563,6 +622,7 @@
static jvmtiError SetBreakpoint(jvmtiEnv* env,
jmethodID method ATTRIBUTE_UNUSED,
jlocation location ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_breakpoint_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -570,6 +630,7 @@
static jvmtiError ClearBreakpoint(jvmtiEnv* env,
jmethodID method ATTRIBUTE_UNUSED,
jlocation location ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_breakpoint_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -577,6 +638,7 @@
static jvmtiError SetFieldAccessWatch(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
jfieldID field ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_field_access_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -584,6 +646,7 @@
static jvmtiError ClearFieldAccessWatch(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
jfieldID field ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_field_access_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -591,6 +654,7 @@
static jvmtiError SetFieldModificationWatch(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
jfieldID field ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_field_modification_events);
return ERR(NOT_IMPLEMENTED);
}
@@ -598,11 +662,13 @@
static jvmtiError ClearFieldModificationWatch(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
jfieldID field ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_generate_field_modification_events);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetLoadedClasses(jvmtiEnv* env, jint* class_count_ptr, jclass** classes_ptr) {
+ ENSURE_VALID_ENV(env);
HeapUtil heap_util(ArtJvmTiEnv::AsArtJvmTiEnv(env)->object_tag_table.get());
return heap_util.GetLoadedClasses(env, class_count_ptr, classes_ptr);
}
@@ -611,6 +677,7 @@
jobject initiating_loader,
jint* class_count_ptr,
jclass** classes_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassLoaderClasses(env, initiating_loader, class_count_ptr, classes_ptr);
}
@@ -618,21 +685,25 @@
jclass klass,
char** signature_ptr,
char** generic_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassSignature(env, klass, signature_ptr, generic_ptr);
}
static jvmtiError GetClassStatus(jvmtiEnv* env, jclass klass, jint* status_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassStatus(env, klass, status_ptr);
}
static jvmtiError GetSourceFileName(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
char** source_name_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_source_file_name);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetClassModifiers(jvmtiEnv* env, jclass klass, jint* modifiers_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassModifiers(env, klass, modifiers_ptr);
}
@@ -640,6 +711,7 @@
jclass klass,
jint* method_count_ptr,
jmethodID** methods_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassMethods(env, klass, method_count_ptr, methods_ptr);
}
@@ -647,6 +719,7 @@
jclass klass,
jint* field_count_ptr,
jfieldID** fields_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassFields(env, klass, field_count_ptr, fields_ptr);
}
@@ -654,6 +727,7 @@
jclass klass,
jint* interface_count_ptr,
jclass** interfaces_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetImplementedInterfaces(env, klass, interface_count_ptr, interfaces_ptr);
}
@@ -661,6 +735,7 @@
jclass klass,
jint* minor_version_ptr,
jint* major_version_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassVersionNumbers(env, klass, minor_version_ptr, major_version_ptr);
}
@@ -669,38 +744,45 @@
jint* constant_pool_count_ptr ATTRIBUTE_UNUSED,
jint* constant_pool_byte_count_ptr ATTRIBUTE_UNUSED,
unsigned char** constant_pool_bytes_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_constant_pool);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError IsInterface(jvmtiEnv* env, jclass klass, jboolean* is_interface_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::IsInterface(env, klass, is_interface_ptr);
}
static jvmtiError IsArrayClass(jvmtiEnv* env,
jclass klass,
jboolean* is_array_class_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::IsArrayClass(env, klass, is_array_class_ptr);
}
static jvmtiError IsModifiableClass(jvmtiEnv* env,
jclass klass,
jboolean* is_modifiable_class_ptr) {
+ ENSURE_VALID_ENV(env);
return Redefiner::IsModifiableClass(env, klass, is_modifiable_class_ptr);
}
static jvmtiError GetClassLoader(jvmtiEnv* env, jclass klass, jobject* classloader_ptr) {
+ ENSURE_VALID_ENV(env);
return ClassUtil::GetClassLoader(env, klass, classloader_ptr);
}
static jvmtiError GetSourceDebugExtension(jvmtiEnv* env,
jclass klass ATTRIBUTE_UNUSED,
char** source_debug_extension_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_source_debug_extension);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_retransform_classes);
std::string error_msg;
jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
@@ -719,6 +801,7 @@
static jvmtiError RedefineClasses(jvmtiEnv* env,
jint class_count,
const jvmtiClassDefinition* class_definitions) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_redefine_classes);
std::string error_msg;
jvmtiError res = Redefiner::RedefineClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
@@ -735,16 +818,19 @@
}
static jvmtiError GetObjectSize(jvmtiEnv* env, jobject object, jlong* size_ptr) {
+ ENSURE_VALID_ENV(env);
return ObjectUtil::GetObjectSize(env, object, size_ptr);
}
static jvmtiError GetObjectHashCode(jvmtiEnv* env, jobject object, jint* hash_code_ptr) {
+ ENSURE_VALID_ENV(env);
return ObjectUtil::GetObjectHashCode(env, object, hash_code_ptr);
}
static jvmtiError GetObjectMonitorUsage(jvmtiEnv* env,
jobject object ATTRIBUTE_UNUSED,
jvmtiMonitorUsage* info_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_monitor_info);
return ERR(NOT_IMPLEMENTED);
}
@@ -755,6 +841,7 @@
char** name_ptr,
char** signature_ptr,
char** generic_ptr) {
+ ENSURE_VALID_ENV(env);
return FieldUtil::GetFieldName(env, klass, field, name_ptr, signature_ptr, generic_ptr);
}
@@ -762,6 +849,7 @@
jclass klass,
jfieldID field,
jclass* declaring_class_ptr) {
+ ENSURE_VALID_ENV(env);
return FieldUtil::GetFieldDeclaringClass(env, klass, field, declaring_class_ptr);
}
@@ -769,6 +857,7 @@
jclass klass,
jfieldID field,
jint* modifiers_ptr) {
+ ENSURE_VALID_ENV(env);
return FieldUtil::GetFieldModifiers(env, klass, field, modifiers_ptr);
}
@@ -776,6 +865,7 @@
jclass klass,
jfieldID field,
jboolean* is_synthetic_ptr) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_synthetic_attribute);
return FieldUtil::IsFieldSynthetic(env, klass, field, is_synthetic_ptr);
}
@@ -785,30 +875,35 @@
char** name_ptr,
char** signature_ptr,
char** generic_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetMethodName(env, method, name_ptr, signature_ptr, generic_ptr);
}
static jvmtiError GetMethodDeclaringClass(jvmtiEnv* env,
jmethodID method,
jclass* declaring_class_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetMethodDeclaringClass(env, method, declaring_class_ptr);
}
static jvmtiError GetMethodModifiers(jvmtiEnv* env,
jmethodID method,
jint* modifiers_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetMethodModifiers(env, method, modifiers_ptr);
}
static jvmtiError GetMaxLocals(jvmtiEnv* env,
jmethodID method,
jint* max_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetMaxLocals(env, method, max_ptr);
}
static jvmtiError GetArgumentsSize(jvmtiEnv* env,
jmethodID method,
jint* size_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetArgumentsSize(env, method, size_ptr);
}
@@ -816,6 +911,7 @@
jmethodID method,
jint* entry_count_ptr,
jvmtiLineNumberEntry** table_ptr) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_line_numbers);
return MethodUtil::GetLineNumberTable(env, method, entry_count_ptr, table_ptr);
}
@@ -824,6 +920,7 @@
jmethodID method,
jlocation* start_location_ptr,
jlocation* end_location_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::GetMethodLocation(env, method, start_location_ptr, end_location_ptr);
}
@@ -831,6 +928,7 @@
jmethodID method ATTRIBUTE_UNUSED,
jint* entry_count_ptr ATTRIBUTE_UNUSED,
jvmtiLocalVariableEntry** table_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_access_local_variables);
return ERR(NOT_IMPLEMENTED);
}
@@ -839,24 +937,29 @@
jmethodID method ATTRIBUTE_UNUSED,
jint* bytecode_count_ptr ATTRIBUTE_UNUSED,
unsigned char** bytecodes_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_bytecodes);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError IsMethodNative(jvmtiEnv* env, jmethodID method, jboolean* is_native_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::IsMethodNative(env, method, is_native_ptr);
}
static jvmtiError IsMethodSynthetic(jvmtiEnv* env, jmethodID method, jboolean* is_synthetic_ptr) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_synthetic_attribute);
return MethodUtil::IsMethodSynthetic(env, method, is_synthetic_ptr);
}
static jvmtiError IsMethodObsolete(jvmtiEnv* env, jmethodID method, jboolean* is_obsolete_ptr) {
+ ENSURE_VALID_ENV(env);
return MethodUtil::IsMethodObsolete(env, method, is_obsolete_ptr);
}
static jvmtiError SetNativeMethodPrefix(jvmtiEnv* env, const char* prefix ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_set_native_method_prefix);
return ERR(NOT_IMPLEMENTED);
}
@@ -864,43 +967,53 @@
static jvmtiError SetNativeMethodPrefixes(jvmtiEnv* env,
jint prefix_count ATTRIBUTE_UNUSED,
char** prefixes ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_set_native_method_prefix);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError CreateRawMonitor(jvmtiEnv* env, const char* name, jrawMonitorID* monitor_ptr) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::CreateRawMonitor(env, name, monitor_ptr);
}
static jvmtiError DestroyRawMonitor(jvmtiEnv* env, jrawMonitorID monitor) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::DestroyRawMonitor(env, monitor);
}
static jvmtiError RawMonitorEnter(jvmtiEnv* env, jrawMonitorID monitor) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::RawMonitorEnter(env, monitor);
}
static jvmtiError RawMonitorExit(jvmtiEnv* env, jrawMonitorID monitor) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::RawMonitorExit(env, monitor);
}
static jvmtiError RawMonitorWait(jvmtiEnv* env, jrawMonitorID monitor, jlong millis) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::RawMonitorWait(env, monitor, millis);
}
static jvmtiError RawMonitorNotify(jvmtiEnv* env, jrawMonitorID monitor) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::RawMonitorNotify(env, monitor);
}
static jvmtiError RawMonitorNotifyAll(jvmtiEnv* env, jrawMonitorID monitor) {
+ ENSURE_VALID_ENV(env);
return MonitorUtil::RawMonitorNotifyAll(env, monitor);
}
static jvmtiError SetJNIFunctionTable(jvmtiEnv* env, const jniNativeInterface* function_table) {
+ ENSURE_VALID_ENV(env);
return JNIUtil::SetJNIFunctionTable(env, function_table);
}
static jvmtiError GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table) {
+ ENSURE_VALID_ENV(env);
return JNIUtil::GetJNIFunctionTable(env, function_table);
}
@@ -955,14 +1068,16 @@
return gEventHandler.SetEvent(art_env, art_thread, GetArtJvmtiEvent(art_env, event_type), mode);
}
- static jvmtiError GenerateEvents(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ static jvmtiError GenerateEvents(jvmtiEnv* env,
jvmtiEvent event_type ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
return OK;
}
- static jvmtiError GetExtensionFunctions(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ static jvmtiError GetExtensionFunctions(jvmtiEnv* env,
jint* extension_count_ptr,
jvmtiExtensionFunctionInfo** extensions) {
+ ENSURE_VALID_ENV(env);
// We do not have any extension functions.
*extension_count_ptr = 0;
*extensions = nullptr;
@@ -970,9 +1085,10 @@
return ERR(NONE);
}
- static jvmtiError GetExtensionEvents(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ static jvmtiError GetExtensionEvents(jvmtiEnv* env,
jint* extension_count_ptr,
jvmtiExtensionEventInfo** extensions) {
+ ENSURE_VALID_ENV(env);
// We do not have any extension events.
*extension_count_ptr = 0;
*extensions = nullptr;
@@ -980,9 +1096,10 @@
return ERR(NONE);
}
- static jvmtiError SetExtensionEventCallback(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ static jvmtiError SetExtensionEventCallback(jvmtiEnv* env,
jint extension_event_index ATTRIBUTE_UNUSED,
jvmtiExtensionEvent callback ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
// We do not have any extension events, so any call is illegal.
return ERR(ILLEGAL_ARGUMENT);
}
@@ -999,8 +1116,8 @@
ENSURE_NON_NULL(capabilities_ptr);
ArtJvmTiEnv* art_env = static_cast<ArtJvmTiEnv*>(env);
jvmtiError ret = OK;
- jvmtiCapabilities changed;
- jvmtiCapabilities potential_capabilities;
+ jvmtiCapabilities changed = {};
+ jvmtiCapabilities potential_capabilities = {};
ret = env->GetPotentialCapabilities(&potential_capabilities);
if (ret != OK) {
return ret;
@@ -1072,7 +1189,7 @@
ENSURE_VALID_ENV(env);
ENSURE_NON_NULL(capabilities_ptr);
ArtJvmTiEnv* art_env = reinterpret_cast<ArtJvmTiEnv*>(env);
- jvmtiCapabilities changed;
+ jvmtiCapabilities changed = {};
#define DEL_CAPABILITY(e) \
do { \
if (capabilities_ptr->e == 1) { \
@@ -1141,17 +1258,20 @@
static jvmtiError GetCurrentThreadCpuTimerInfo(jvmtiEnv* env,
jvmtiTimerInfo* info_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_current_thread_cpu_time);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetCurrentThreadCpuTime(jvmtiEnv* env, jlong* nanos_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_current_thread_cpu_time);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetThreadCpuTimerInfo(jvmtiEnv* env,
jvmtiTimerInfo* info_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_thread_cpu_time);
return ERR(NOT_IMPLEMENTED);
}
@@ -1159,43 +1279,53 @@
static jvmtiError GetThreadCpuTime(jvmtiEnv* env,
jthread thread ATTRIBUTE_UNUSED,
jlong* nanos_ptr ATTRIBUTE_UNUSED) {
+ ENSURE_VALID_ENV(env);
ENSURE_HAS_CAP(env, can_get_thread_cpu_time);
return ERR(NOT_IMPLEMENTED);
}
static jvmtiError GetTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr) {
+ ENSURE_VALID_ENV(env);
return TimerUtil::GetTimerInfo(env, info_ptr);
}
static jvmtiError GetTime(jvmtiEnv* env, jlong* nanos_ptr) {
+ ENSURE_VALID_ENV(env);
return TimerUtil::GetTime(env, nanos_ptr);
}
static jvmtiError GetAvailableProcessors(jvmtiEnv* env, jint* processor_count_ptr) {
+ ENSURE_VALID_ENV(env);
return TimerUtil::GetAvailableProcessors(env, processor_count_ptr);
}
static jvmtiError AddToBootstrapClassLoaderSearch(jvmtiEnv* env, const char* segment) {
+ ENSURE_VALID_ENV(env);
return SearchUtil::AddToBootstrapClassLoaderSearch(env, segment);
}
static jvmtiError AddToSystemClassLoaderSearch(jvmtiEnv* env, const char* segment) {
+ ENSURE_VALID_ENV(env);
return SearchUtil::AddToSystemClassLoaderSearch(env, segment);
}
static jvmtiError GetSystemProperties(jvmtiEnv* env, jint* count_ptr, char*** property_ptr) {
+ ENSURE_VALID_ENV(env);
return PropertiesUtil::GetSystemProperties(env, count_ptr, property_ptr);
}
static jvmtiError GetSystemProperty(jvmtiEnv* env, const char* property, char** value_ptr) {
+ ENSURE_VALID_ENV(env);
return PropertiesUtil::GetSystemProperty(env, property, value_ptr);
}
static jvmtiError SetSystemProperty(jvmtiEnv* env, const char* property, const char* value) {
+ ENSURE_VALID_ENV(env);
return PropertiesUtil::SetSystemProperty(env, property, value);
}
static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr) {
+ ENSURE_VALID_ENV(env);
return PhaseUtil::GetPhase(env, phase_ptr);
}
@@ -1303,9 +1433,10 @@
}
}
- static jvmtiError SetVerboseFlag(jvmtiEnv* env ATTRIBUTE_UNUSED,
+ static jvmtiError SetVerboseFlag(jvmtiEnv* env,
jvmtiVerboseFlag flag,
jboolean value) {
+ ENSURE_VALID_ENV(env);
if (flag == jvmtiVerboseFlag::JVMTI_VERBOSE_OTHER) {
// OTHER is special, as it's 0, so can't do a bit check.
bool val = (value == JNI_TRUE) ? true : false;
@@ -1359,8 +1490,8 @@
return ERR(NONE);
}
- static jvmtiError GetJLocationFormat(jvmtiEnv* env ATTRIBUTE_UNUSED,
- jvmtiJlocationFormat* format_ptr) {
+ static jvmtiError GetJLocationFormat(jvmtiEnv* env, jvmtiJlocationFormat* format_ptr) {
+ ENSURE_VALID_ENV(env);
// Report BCI as jlocation format. We report dex bytecode indices.
if (format_ptr == nullptr) {
return ERR(NULL_POINTER);
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index 4f5eb0c..d88805e 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -126,6 +126,7 @@
unsigned char** new_class_data) const {
static_assert(kEvent == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
kEvent == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable, "Unsupported event");
+ DCHECK(*new_class_data == nullptr);
jint current_len = class_data_len;
unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
ArtJvmTiEnv* last_env = nullptr;
diff --git a/runtime/openjdkjvmti/ti_class.cc b/runtime/openjdkjvmti/ti_class.cc
index 2d1b25e..38fd1d4 100644
--- a/runtime/openjdkjvmti/ti_class.cc
+++ b/runtime/openjdkjvmti/ti_class.cc
@@ -259,7 +259,7 @@
}
// Actually set the ClassExt's original bytes once we have actually succeeded.
- ext->SetOriginalDexFileBytes(arr.Get());
+ ext->SetOriginalDexFile(arr.Get());
// Set the return values
*final_class_def = &dex_file->GetClassDef(0);
*final_dex_file = dex_file.release();
diff --git a/runtime/openjdkjvmti/ti_class_definition.h b/runtime/openjdkjvmti/ti_class_definition.h
index 3c251d4..9ca1c07 100644
--- a/runtime/openjdkjvmti/ti_class_definition.h
+++ b/runtime/openjdkjvmti/ti_class_definition.h
@@ -49,7 +49,16 @@
JvmtiUniquePtr<unsigned char> dex_data;
art::ArraySlice<const unsigned char> original_dex_file;
- ArtClassDefinition() = default;
+ ArtClassDefinition()
+ : klass(nullptr),
+ loader(nullptr),
+ name(),
+ protection_domain(nullptr),
+ dex_len(0),
+ dex_data(nullptr),
+ original_dex_file(),
+ modified(false) {}
+
ArtClassDefinition(ArtClassDefinition&& o) = default;
void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 9c1d6ef..7faddfb 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -469,7 +469,7 @@
result_ = result;
}
-art::mirror::ByteArray* Redefiner::ClassRedefinition::AllocateOrGetOriginalDexFileBytes() {
+art::mirror::Object* Redefiner::ClassRedefinition::AllocateOrGetOriginalDexFile() {
// If we have been specifically given a new set of bytes use that
if (original_dex_file_.size() != 0) {
return art::mirror::ByteArray::AllocateAndFill(
@@ -481,24 +481,21 @@
// See if we already have one set.
art::ObjPtr<art::mirror::ClassExt> ext(GetMirrorClass()->GetExtData());
if (!ext.IsNull()) {
- art::ObjPtr<art::mirror::ByteArray> old_original_bytes(ext->GetOriginalDexFileBytes());
- if (!old_original_bytes.IsNull()) {
+ art::ObjPtr<art::mirror::Object> old_original_dex_file(ext->GetOriginalDexFile());
+ if (!old_original_dex_file.IsNull()) {
// We do. Use it.
- return old_original_bytes.Ptr();
+ return old_original_dex_file.Ptr();
}
}
- // Copy the current dex_file
- const art::DexFile& current_dex_file = GetMirrorClass()->GetDexFile();
+ // return the current dex_cache which has the dex file in it.
+ art::ObjPtr<art::mirror::DexCache> current_dex_cache(GetMirrorClass()->GetDexCache());
// TODO Handle this or make it so it cannot happen.
- if (current_dex_file.NumClassDefs() != 1) {
+ if (current_dex_cache->GetDexFile()->NumClassDefs() != 1) {
LOG(WARNING) << "Current dex file has more than one class in it. Calling RetransformClasses "
<< "on this class might fail if no transformations are applied to it!";
}
- return art::mirror::ByteArray::AllocateAndFill(
- driver_->self_,
- reinterpret_cast<const signed char*>(current_dex_file.Begin()),
- current_dex_file.Size());
+ return current_dex_cache.Ptr();
}
struct CallbackCtx {
@@ -847,9 +844,9 @@
return art::down_cast<art::mirror::Class*>(GetSlot(klass_index, kSlotMirrorClass));
}
- art::mirror::ByteArray* GetOriginalDexFileBytes(jint klass_index) const
+ art::mirror::Object* GetOriginalDexFile(jint klass_index) const
REQUIRES_SHARED(art::Locks::mutator_lock_) {
- return art::down_cast<art::mirror::ByteArray*>(GetSlot(klass_index, kSlotOrigDexFile));
+ return art::down_cast<art::mirror::Object*>(GetSlot(klass_index, kSlotOrigDexFile));
}
void SetSourceClassLoader(jint klass_index, art::mirror::ClassLoader* loader)
@@ -872,7 +869,7 @@
REQUIRES_SHARED(art::Locks::mutator_lock_) {
SetSlot(klass_index, kSlotMirrorClass, klass);
}
- void SetOriginalDexFileBytes(jint klass_index, art::mirror::ByteArray* bytes)
+ void SetOriginalDexFile(jint klass_index, art::mirror::Object* bytes)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
SetSlot(klass_index, kSlotOrigDexFile, bytes);
}
@@ -985,9 +982,9 @@
art::mirror::Class* GetMirrorClass() const REQUIRES_SHARED(art::Locks::mutator_lock_) {
return holder_.GetMirrorClass(idx_);
}
- art::mirror::ByteArray* GetOriginalDexFileBytes() const
+ art::mirror::Object* GetOriginalDexFile() const
REQUIRES_SHARED(art::Locks::mutator_lock_) {
- return holder_.GetOriginalDexFileBytes(idx_);
+ return holder_.GetOriginalDexFile(idx_);
}
int32_t GetIndex() const {
return idx_;
@@ -1010,9 +1007,9 @@
void SetMirrorClass(art::mirror::Class* klass) REQUIRES_SHARED(art::Locks::mutator_lock_) {
holder_.SetMirrorClass(idx_, klass);
}
- void SetOriginalDexFileBytes(art::mirror::ByteArray* bytes)
+ void SetOriginalDexFile(art::mirror::Object* bytes)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
- holder_.SetOriginalDexFileBytes(idx_, bytes);
+ holder_.SetOriginalDexFile(idx_, bytes);
}
private:
@@ -1138,8 +1135,8 @@
}
// We won't always need to set this field.
- cur_data->SetOriginalDexFileBytes(AllocateOrGetOriginalDexFileBytes());
- if (cur_data->GetOriginalDexFileBytes() == nullptr) {
+ cur_data->SetOriginalDexFile(AllocateOrGetOriginalDexFile());
+ if (cur_data->GetOriginalDexFile() == nullptr) {
driver_->self_->AssertPendingOOMException();
driver_->self_->ClearException();
RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate array for original dex file");
@@ -1285,7 +1282,7 @@
art::mirror::Class* klass = data.GetMirrorClass();
// TODO Rewrite so we don't do a stack walk for each and every class.
redef.FindAndAllocateObsoleteMethods(klass);
- redef.UpdateClass(klass, data.GetNewDexCache(), data.GetOriginalDexFileBytes());
+ redef.UpdateClass(klass, data.GetNewDexCache(), data.GetOriginalDexFile());
}
// TODO We should check for if any of the redefined methods are intrinsic methods here and, if any
// are, force a full-world deoptimization before finishing redefinition. If we don't do this then
@@ -1365,7 +1362,7 @@
void Redefiner::ClassRedefinition::UpdateClass(
art::ObjPtr<art::mirror::Class> mclass,
art::ObjPtr<art::mirror::DexCache> new_dex_cache,
- art::ObjPtr<art::mirror::ByteArray> original_dex_file) {
+ art::ObjPtr<art::mirror::Object> original_dex_file) {
DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
UpdateMethods(mclass, new_dex_cache, class_def);
@@ -1379,7 +1376,7 @@
mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
art::ObjPtr<art::mirror::ClassExt> ext(mclass->GetExtData());
CHECK(!ext.IsNull());
- ext->SetOriginalDexFileBytes(original_dex_file);
+ ext->SetOriginalDexFile(original_dex_file);
}
// This function does all (java) allocations we need to do for the Class being redefined.
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 4313a94..6c09d46 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -137,7 +137,7 @@
REQUIRES_SHARED(art::Locks::mutator_lock_);
// This may return nullptr with a OOME pending if allocation fails.
- art::mirror::ByteArray* AllocateOrGetOriginalDexFileBytes()
+ art::mirror::Object* AllocateOrGetOriginalDexFile()
REQUIRES_SHARED(art::Locks::mutator_lock_);
void RecordFailure(jvmtiError e, const std::string& err) {
@@ -196,7 +196,7 @@
void UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
art::ObjPtr<art::mirror::DexCache> new_dex_cache,
- art::ObjPtr<art::mirror::ByteArray> original_dex_file)
+ art::ObjPtr<art::mirror::Object> original_dex_file)
REQUIRES(art::Locks::mutator_lock_);
void ReleaseDexFile() REQUIRES_SHARED(art::Locks::mutator_lock_);
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index bd52cbb..06aecba 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -150,16 +150,27 @@
art::Handle<art::mirror::Class> klass,
/*out*/jint* dex_data_len,
/*out*/unsigned char** dex_data) {
- art::StackHandleScope<2> hs(art::Thread::Current());
+ art::StackHandleScope<3> hs(art::Thread::Current());
art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->GetExtData()));
if (!ext.IsNull()) {
- art::Handle<art::mirror::ByteArray> orig_dex(hs.NewHandle(ext->GetOriginalDexFileBytes()));
+ art::Handle<art::mirror::Object> orig_dex(hs.NewHandle(ext->GetOriginalDexFile()));
if (!orig_dex.IsNull()) {
- *dex_data_len = static_cast<jint>(orig_dex->GetLength());
- return CopyDataIntoJvmtiBuffer(env,
- reinterpret_cast<const unsigned char*>(orig_dex->GetData()),
- *dex_data_len,
- /*out*/dex_data);
+ if (orig_dex->IsArrayInstance()) {
+ DCHECK(orig_dex->GetClass()->GetComponentType()->IsPrimitiveByte());
+ art::Handle<art::mirror::ByteArray> orig_dex_bytes(
+ hs.NewHandle(art::down_cast<art::mirror::ByteArray*>(orig_dex->AsArray())));
+ *dex_data_len = static_cast<jint>(orig_dex_bytes->GetLength());
+ return CopyDataIntoJvmtiBuffer(
+ env,
+ reinterpret_cast<const unsigned char*>(orig_dex_bytes->GetData()),
+ *dex_data_len,
+ /*out*/dex_data);
+ } else {
+ DCHECK(orig_dex->IsDexCache());
+ const art::DexFile* dex_file = orig_dex->AsDexCache()->GetDexFile();
+ *dex_data_len = static_cast<jint>(dex_file->Size());
+ return CopyDataIntoJvmtiBuffer(env, dex_file->Begin(), dex_file->Size(), /*out*/dex_data);
+ }
}
}
// TODO De-quicken the dex file before passing it to the agents.
diff --git a/runtime/primitive.cc b/runtime/primitive.cc
index 2380284..1ec345a 100644
--- a/runtime/primitive.cc
+++ b/runtime/primitive.cc
@@ -44,7 +44,7 @@
"Ljava/lang/Void;",
};
-#define COUNT_OF(x) (sizeof(x) / sizeof(x[0]))
+#define COUNT_OF(x) (sizeof(x) / sizeof((x)[0]))
const char* Primitive::PrettyDescriptor(Primitive::Type type) {
static_assert(COUNT_OF(kTypeNames) == static_cast<size_t>(Primitive::kPrimLast) + 1,
diff --git a/runtime/stack.h b/runtime/stack.h
index 5c9614a..bdaa4c3 100644
--- a/runtime/stack.h
+++ b/runtime/stack.h
@@ -430,8 +430,15 @@
private:
ShadowFrame(uint32_t num_vregs, ShadowFrame* link, ArtMethod* method,
uint32_t dex_pc, bool has_reference_array)
- : link_(link), method_(method), result_register_(nullptr), dex_pc_ptr_(nullptr),
- code_item_(nullptr), number_of_vregs_(num_vregs), dex_pc_(dex_pc) {
+ : link_(link),
+ method_(method),
+ result_register_(nullptr),
+ dex_pc_ptr_(nullptr),
+ code_item_(nullptr),
+ number_of_vregs_(num_vregs),
+ dex_pc_(dex_pc),
+ cached_hotness_countdown_(0),
+ hotness_countdown_(0) {
// TODO(iam): Remove this parameter, it's an an artifact of portable removal
DCHECK(has_reference_array);
if (has_reference_array) {
diff --git a/runtime/stack_map.h b/runtime/stack_map.h
index ffa17c9..a224986 100644
--- a/runtime/stack_map.h
+++ b/runtime/stack_map.h
@@ -688,7 +688,13 @@
class StackMapEncoding {
public:
- StackMapEncoding() {}
+ StackMapEncoding()
+ : dex_pc_bit_offset_(0),
+ dex_register_map_bit_offset_(0),
+ inline_info_bit_offset_(0),
+ register_mask_index_bit_offset_(0),
+ stack_mask_index_bit_offset_(0),
+ total_bit_size_(0) {}
// Set stack map bit layout based on given sizes.
// Returns the size of stack map in bits.
diff --git a/runtime/transaction.h b/runtime/transaction.h
index 7aa98cd..0333fe8 100644
--- a/runtime/transaction.h
+++ b/runtime/transaction.h
@@ -162,7 +162,7 @@
FieldValueKind kind;
bool is_volatile;
- FieldValue() = default;
+ FieldValue() : value(0), kind(FieldValueKind::kBoolean), is_volatile(false) {}
FieldValue(FieldValue&& log) = default;
private:
diff --git a/sigchainlib/sigchain.cc b/sigchainlib/sigchain.cc
index c1efecd..1727f88 100644
--- a/sigchainlib/sigchain.cc
+++ b/sigchainlib/sigchain.cc
@@ -26,77 +26,38 @@
#include <stdio.h>
#include <stdlib.h>
+#include <utility>
+
#include "sigchain.h"
#if defined(__APPLE__)
#define _NSIG NSIG
#define sighandler_t sig_t
+
+// Darwin has an #error when ucontext.h is included without _XOPEN_SOURCE defined.
+#define _XOPEN_SOURCE
#endif
-namespace art {
+#include <ucontext.h>
-typedef int (*SigActionFnPtr)(int, const struct sigaction*, struct sigaction*);
+// libsigchain provides an interception layer for signal handlers, to allow ART and others to give
+// their signal handlers the first stab at handling signals before passing them on to user code.
+//
+// It implements wrapper functions for signal, sigaction, and sigprocmask, and a handler that
+// forwards signals appropriately.
+//
+// In our handler, we start off with all signals blocked, fetch the original signal mask from the
+// passed in ucontext, and then adjust our signal mask appropriately for the user handler.
+//
+// It's somewhat tricky for us to properly handle some flag cases:
+// SA_NOCLDSTOP and SA_NOCLDWAIT: shouldn't matter, we don't have special handlers for SIGCHLD.
+// SA_NODEFER: unimplemented, we can manually change the signal mask appropriately.
+// ~SA_ONSTACK: always silently enable this
+// SA_RESETHAND: unimplemented, but we can probably do this?
+// ~SA_RESTART: unimplemented, maybe we can reserve an RT signal, register an empty handler that
+// doesn't have SA_RESTART, and raise the signal to avoid restarting syscalls that are
+// expected to be interrupted?
-class SignalAction {
- public:
- SignalAction() : claimed_(false), uses_old_style_(false), special_handler_(nullptr) {
- }
-
- // Claim the signal and keep the action specified.
- void Claim(const struct sigaction& action) {
- action_ = action;
- claimed_ = true;
- }
-
- // Unclaim the signal and restore the old action.
- void Unclaim(int signal) {
- claimed_ = false;
- sigaction(signal, &action_, nullptr); // Restore old action.
- }
-
- // Get the action associated with this signal.
- const struct sigaction& GetAction() const {
- return action_;
- }
-
- // Is the signal claimed?
- bool IsClaimed() const {
- return claimed_;
- }
-
- // Change the recorded action to that specified.
- // If oldstyle is true then this action is from an older style signal()
- // call as opposed to sigaction(). In this case the sa_handler is
- // used when invoking the user's handler.
- void SetAction(const struct sigaction& action, bool oldstyle) {
- action_ = action;
- uses_old_style_ = oldstyle;
- }
-
- bool OldStyle() const {
- return uses_old_style_;
- }
-
- void SetSpecialHandler(SpecialSignalHandlerFn fn) {
- special_handler_ = fn;
- }
-
- SpecialSignalHandlerFn GetSpecialHandler() {
- return special_handler_;
- }
-
- private:
- struct sigaction action_; // Action to be performed.
- bool claimed_; // Whether signal is claimed or not.
- bool uses_old_style_; // Action is created using signal(). Use sa_handler.
- SpecialSignalHandlerFn special_handler_; // A special handler executed before user handlers.
-};
-
-// User's signal handlers
-static SignalAction user_sigactions[_NSIG];
-static bool initialized;
-static void* linked_sigaction_sym;
-static void* linked_sigprocmask_sym;
static void log(const char* format, ...) {
char buf[256];
@@ -111,102 +72,186 @@
va_end(ap);
}
-static void CheckSignalValid(int signal) {
- if (signal <= 0 || signal >= _NSIG) {
- log("Invalid signal %d", signal);
- abort();
- }
-}
+#define fatal(...) log(__VA_ARGS__); abort()
-// Sigchainlib's own handler so we can ensure a managed handler is called first even if nobody
-// claimed a chain. Simply forward to InvokeUserSignalHandler.
-static void sigchainlib_managed_handler_sigaction(int sig, siginfo_t* info, void* context) {
- InvokeUserSignalHandler(sig, info, context);
-}
-
-// Claim a signal chain for a particular signal.
-extern "C" void ClaimSignalChain(int signal, struct sigaction* oldaction) {
- CheckSignalValid(signal);
-
- user_sigactions[signal].Claim(*oldaction);
-}
-
-extern "C" void UnclaimSignalChain(int signal) {
- CheckSignalValid(signal);
-
- user_sigactions[signal].Unclaim(signal);
-}
-
-// Invoke the user's signal handler.
-extern "C" void InvokeUserSignalHandler(int sig, siginfo_t* info, void* context) {
- // Check the arguments.
- CheckSignalValid(sig);
-
- // The signal must have been claimed in order to get here. Check it.
- if (!user_sigactions[sig].IsClaimed()) {
- abort();
- }
-
- // Do we have a managed handler? If so, run it first.
- SpecialSignalHandlerFn managed = user_sigactions[sig].GetSpecialHandler();
- if (managed != nullptr) {
- sigset_t mask, old_mask;
- sigfillset(&mask);
- sigprocmask(SIG_BLOCK, &mask, &old_mask);
- // Call the handler. If it succeeds, we're done.
- if (managed(sig, info, context)) {
- sigprocmask(SIG_SETMASK, &old_mask, nullptr);
- return;
+static int sigorset(sigset_t* dest, sigset_t* left, sigset_t* right) {
+ sigemptyset(dest);
+ for (size_t i = 0; i < sizeof(sigset_t) * CHAR_BIT; ++i) {
+ if (sigismember(left, i) == 1 || sigismember(right, i) == 1) {
+ sigaddset(dest, i);
}
- sigprocmask(SIG_SETMASK, &old_mask, nullptr);
+ }
+ return 0;
+}
+
+namespace art {
+
+static decltype(&sigaction) linked_sigaction;
+static decltype(&sigprocmask) linked_sigprocmask;
+__thread bool handling_signal;
+
+class SignalChain {
+ public:
+ SignalChain() : claimed_(false) {
}
- const struct sigaction& action = user_sigactions[sig].GetAction();
- if (user_sigactions[sig].OldStyle()) {
- if (action.sa_handler != nullptr) {
- action.sa_handler(sig);
- } else {
- signal(sig, SIG_DFL);
- raise(sig);
+ bool IsClaimed() {
+ return claimed_;
+ }
+
+ void Claim(int signo) {
+ if (!claimed_) {
+ Register(signo);
+ claimed_ = true;
}
+ }
+
+ // Register the signal chain with the kernel if needed.
+ void Register(int signo) {
+ struct sigaction handler_action = {};
+ handler_action.sa_sigaction = SignalChain::Handler;
+ handler_action.sa_flags = SA_RESTART | SA_SIGINFO | SA_ONSTACK;
+ sigfillset(&handler_action.sa_mask);
+ linked_sigaction(signo, &handler_action, &action_);
+ }
+
+ void SetAction(const struct sigaction* action) {
+ action_ = *action;
+ }
+
+ struct sigaction GetAction() {
+ return action_;
+ }
+
+ void AddSpecialHandler(SpecialSignalHandlerFn fn) {
+ for (SpecialSignalHandlerFn& slot : special_handlers_) {
+ if (slot == nullptr) {
+ slot = fn;
+ return;
+ }
+ }
+
+ fatal("too many special signal handlers");
+ }
+
+ void RemoveSpecialHandler(SpecialSignalHandlerFn fn) {
+ // This isn't thread safe, but it's unlikely to be a real problem.
+ size_t len = sizeof(special_handlers_)/sizeof(*special_handlers_);
+ for (size_t i = 0; i < len; ++i) {
+ if (special_handlers_[i] == fn) {
+ for (size_t j = i; j < len - 1; ++j) {
+ special_handlers_[j] = special_handlers_[j + 1];
+ }
+ special_handlers_[len - 1] = nullptr;
+ return;
+ }
+ }
+
+ fatal("failed to find special handler to remove");
+ }
+
+
+ static void Handler(int signo, siginfo_t* siginfo, void*);
+
+ private:
+ bool claimed_;
+ struct sigaction action_;
+ SpecialSignalHandlerFn special_handlers_[2];
+};
+
+static SignalChain chains[_NSIG];
+
+class ScopedFlagRestorer {
+ public:
+ explicit ScopedFlagRestorer(bool* flag) : flag_(flag), original_value_(*flag) {
+ }
+
+ ~ScopedFlagRestorer() {
+ *flag_ = original_value_;
+ }
+
+ private:
+ bool* flag_;
+ bool original_value_;
+};
+
+class ScopedSignalUnblocker {
+ public:
+ explicit ScopedSignalUnblocker(const std::initializer_list<int>& signals) {
+ sigset_t new_mask;
+ sigemptyset(&new_mask);
+ for (int signal : signals) {
+ sigaddset(&new_mask, signal);
+ }
+ if (sigprocmask(SIG_UNBLOCK, &new_mask, &previous_mask_) != 0) {
+ fatal("failed to unblock signals: %s", strerror(errno));
+ }
+ }
+
+ ~ScopedSignalUnblocker() {
+ if (sigprocmask(SIG_SETMASK, &previous_mask_, nullptr) != 0) {
+ fatal("failed to unblock signals: %s", strerror(errno));
+ }
+ }
+
+ private:
+ sigset_t previous_mask_;
+};
+
+void SignalChain::Handler(int signo, siginfo_t* siginfo, void* ucontext_raw) {
+ ScopedFlagRestorer flag(&handling_signal);
+
+ // Try the special handlers first.
+ // If one of them crashes, we'll reenter this handler and pass that crash onto the user handler.
+ if (!handling_signal) {
+ ScopedSignalUnblocker unblocked { SIGABRT, SIGBUS, SIGFPE, SIGILL, SIGSEGV }; // NOLINT
+ handling_signal = true;
+
+ for (const auto& handler : chains[signo].special_handlers_) {
+ if (handler != nullptr && handler(signo, siginfo, ucontext_raw)) {
+ return;
+ }
+ }
+ }
+
+ // Forward to the user's signal handler.
+ int handler_flags = chains[signo].action_.sa_flags;
+ ucontext_t* ucontext = static_cast<ucontext_t*>(ucontext_raw);
+ sigset_t mask;
+ sigorset(&mask, &ucontext->uc_sigmask, &chains[signo].action_.sa_mask);
+ if ((handler_flags & SA_NODEFER)) {
+ sigdelset(&mask, signo);
+ }
+ sigprocmask(SIG_SETMASK, &mask, nullptr);
+
+ if ((handler_flags & SA_SIGINFO)) {
+ chains[signo].action_.sa_sigaction(signo, siginfo, ucontext_raw);
} else {
- if (action.sa_sigaction != nullptr) {
- sigset_t old_mask;
- sigprocmask(SIG_BLOCK, &action.sa_mask, &old_mask);
- action.sa_sigaction(sig, info, context);
- sigprocmask(SIG_SETMASK, &old_mask, nullptr);
+ auto handler = chains[signo].action_.sa_handler;
+ if (handler == SIG_IGN) {
+ return;
+ } else if (handler == SIG_DFL) {
+ fatal("exiting due to SIG_DFL handler for signal %d", signo);
} else {
- signal(sig, SIG_DFL);
- raise(sig);
+ handler(signo);
}
}
}
-extern "C" void EnsureFrontOfChain(int signal, struct sigaction* expected_action) {
- CheckSignalValid(signal);
- // Read the current action without looking at the chain, it should be the expected action.
- SigActionFnPtr linked_sigaction = reinterpret_cast<SigActionFnPtr>(linked_sigaction_sym);
- struct sigaction current_action;
- linked_sigaction(signal, nullptr, ¤t_action);
- // If the sigactions don't match then we put the current action on the chain and make ourself as
- // the main action.
- if (current_action.sa_sigaction != expected_action->sa_sigaction) {
- log("Warning: Unexpected sigaction action found %p\n", current_action.sa_sigaction);
- user_sigactions[signal].Claim(current_action);
- linked_sigaction(signal, expected_action, nullptr);
- }
-}
-
extern "C" int sigaction(int signal, const struct sigaction* new_action, struct sigaction* old_action) {
// If this signal has been claimed as a signal chain, record the user's
// action but don't pass it on to the kernel.
// Note that we check that the signal number is in range here. An out of range signal
// number should behave exactly as the libc sigaction.
- if (signal > 0 && signal < _NSIG && user_sigactions[signal].IsClaimed() &&
- (new_action == nullptr || new_action->sa_handler != SIG_DFL)) {
- struct sigaction saved_action = user_sigactions[signal].GetAction();
+ if (signal < 0 || signal >= _NSIG) {
+ errno = EINVAL;
+ return -1;
+ }
+
+ if (chains[signal].IsClaimed()) {
+ struct sigaction saved_action = chains[signal].GetAction();
if (new_action != nullptr) {
- user_sigactions[signal].SetAction(*new_action, false);
+ chains[signal].SetAction(new_action);
}
if (old_action != nullptr) {
*old_action = saved_action;
@@ -216,73 +261,52 @@
// Will only get here if the signal chain has not been claimed. We want
// to pass the sigaction on to the kernel via the real sigaction in libc.
-
- if (linked_sigaction_sym == nullptr) {
- // Perform lazy initialization.
- // This will only occur outside of a signal context since we have
- // not been initialized and therefore cannot be within the ART
- // runtime.
- InitializeSignalChain();
- }
-
- if (linked_sigaction_sym == nullptr) {
- log("Unable to find next sigaction in signal chain");
- abort();
- }
- SigActionFnPtr linked_sigaction = reinterpret_cast<SigActionFnPtr>(linked_sigaction_sym);
+ InitializeSignalChain();
return linked_sigaction(signal, new_action, old_action);
}
-static sighandler_t signal_impl(int signal, sighandler_t handler) {
- struct sigaction sa;
+extern "C" sighandler_t signal(int signo, sighandler_t handler) {
+ if (signo < 0 || signo > _NSIG) {
+ errno = EINVAL;
+ return SIG_ERR;
+ }
+
+ struct sigaction sa = {};
sigemptyset(&sa.sa_mask);
sa.sa_handler = handler;
- sa.sa_flags = SA_RESTART;
+ sa.sa_flags = SA_RESTART | SA_ONSTACK;
sighandler_t oldhandler;
// If this signal has been claimed as a signal chain, record the user's
// action but don't pass it on to the kernel.
- // Note that we check that the signal number is in range here. An out of range signal
- // number should behave exactly as the libc sigaction.
- if (signal > 0 && signal < _NSIG && user_sigactions[signal].IsClaimed() && handler != SIG_DFL) {
- oldhandler = reinterpret_cast<sighandler_t>(user_sigactions[signal].GetAction().sa_handler);
- user_sigactions[signal].SetAction(sa, true);
+ if (chains[signo].IsClaimed()) {
+ oldhandler = reinterpret_cast<sighandler_t>(chains[signo].GetAction().sa_handler);
+ chains[signo].SetAction(&sa);
return oldhandler;
}
// Will only get here if the signal chain has not been claimed. We want
// to pass the sigaction on to the kernel via the real sigaction in libc.
-
- if (linked_sigaction_sym == nullptr) {
- // Perform lazy initialization.
- InitializeSignalChain();
- }
-
- if (linked_sigaction_sym == nullptr) {
- log("Unable to find next sigaction in signal chain");
- abort();
- }
-
- typedef int (*SigAction)(int, const struct sigaction*, struct sigaction*);
- SigAction linked_sigaction = reinterpret_cast<SigAction>(linked_sigaction_sym);
- if (linked_sigaction(signal, &sa, &sa) == -1) {
+ InitializeSignalChain();
+ if (linked_sigaction(signo, &sa, &sa) == -1) {
return SIG_ERR;
}
return reinterpret_cast<sighandler_t>(sa.sa_handler);
}
-extern "C" sighandler_t signal(int signal, sighandler_t handler) {
- return signal_impl(signal, handler);
-}
-
#if !defined(__LP64__)
-extern "C" sighandler_t bsd_signal(int signal, sighandler_t handler) {
- return signal_impl(signal, handler);
+extern "C" sighandler_t bsd_signal(int signo, sighandler_t handler) {
+ return signal(signo, handler);
}
#endif
extern "C" int sigprocmask(int how, const sigset_t* bionic_new_set, sigset_t* bionic_old_set) {
+ // When inside a signal handler, forward directly to the actual sigprocmask.
+ if (handling_signal) {
+ return linked_sigprocmask(how, bionic_new_set, bionic_old_set);
+ }
+
const sigset_t* new_set_ptr = bionic_new_set;
sigset_t tmpset;
if (bionic_new_set != nullptr) {
@@ -292,7 +316,7 @@
// Don't allow claimed signals in the mask. If a signal chain has been claimed
// we can't allow the user to block that signal.
for (int i = 0 ; i < _NSIG; ++i) {
- if (user_sigactions[i].IsClaimed() && sigismember(&tmpset, i)) {
+ if (chains[i].IsClaimed() && sigismember(&tmpset, i)) {
sigdelset(&tmpset, i);
}
}
@@ -300,18 +324,7 @@
new_set_ptr = &tmpset;
}
- if (linked_sigprocmask_sym == nullptr) {
- // Perform lazy initialization.
- InitializeSignalChain();
- }
-
- if (linked_sigprocmask_sym == nullptr) {
- log("Unable to find next sigprocmask in signal chain");
- abort();
- }
-
- typedef int (*SigProcMask)(int how, const sigset_t*, sigset_t*);
- SigProcMask linked_sigprocmask= reinterpret_cast<SigProcMask>(linked_sigprocmask_sym);
+ InitializeSignalChain();
return linked_sigprocmask(how, new_set_ptr, bionic_old_set);
}
@@ -322,49 +335,67 @@
// taken and if it so happens that a signal occurs while one of these
// locks is already taken, dlsym will block trying to reenter a
// mutex and we will never get out of it.
+ static bool initialized = false;
if (initialized) {
// Don't initialize twice.
return;
}
- linked_sigaction_sym = dlsym(RTLD_NEXT, "sigaction");
+
+ void* linked_sigaction_sym = dlsym(RTLD_NEXT, "sigaction");
if (linked_sigaction_sym == nullptr) {
linked_sigaction_sym = dlsym(RTLD_DEFAULT, "sigaction");
if (linked_sigaction_sym == nullptr ||
linked_sigaction_sym == reinterpret_cast<void*>(sigaction)) {
- linked_sigaction_sym = nullptr;
+ fatal("Unable to find next sigaction in signal chain");
}
}
- linked_sigprocmask_sym = dlsym(RTLD_NEXT, "sigprocmask");
+ void* linked_sigprocmask_sym = dlsym(RTLD_NEXT, "sigprocmask");
if (linked_sigprocmask_sym == nullptr) {
linked_sigprocmask_sym = dlsym(RTLD_DEFAULT, "sigprocmask");
if (linked_sigprocmask_sym == nullptr ||
linked_sigprocmask_sym == reinterpret_cast<void*>(sigprocmask)) {
- linked_sigprocmask_sym = nullptr;
+ fatal("Unable to find next sigprocmask in signal chain");
}
}
+
+ linked_sigaction = reinterpret_cast<decltype(linked_sigaction)>(linked_sigaction_sym);
+ linked_sigprocmask = reinterpret_cast<decltype(linked_sigprocmask)>(linked_sigprocmask_sym);
initialized = true;
}
-extern "C" void SetSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn) {
- CheckSignalValid(signal);
+extern "C" void AddSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn) {
+ if (signal <= 0 || signal >= _NSIG) {
+ fatal("Invalid signal %d", signal);
+ }
// Set the managed_handler.
- user_sigactions[signal].SetSpecialHandler(fn);
+ chains[signal].AddSpecialHandler(fn);
+ chains[signal].Claim(signal);
+}
- // In case the chain isn't claimed, claim it for ourself so we can ensure the managed handler
- // goes first.
- if (!user_sigactions[signal].IsClaimed()) {
- struct sigaction act, old_act;
- act.sa_sigaction = sigchainlib_managed_handler_sigaction;
- sigemptyset(&act.sa_mask);
- act.sa_flags = SA_SIGINFO | SA_ONSTACK;
-#if !defined(__APPLE__) && !defined(__mips__)
- act.sa_restorer = nullptr;
-#endif
- if (sigaction(signal, &act, &old_act) != -1) {
- user_sigactions[signal].Claim(old_act);
- }
+extern "C" void RemoveSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn) {
+ if (signal <= 0 || signal >= _NSIG) {
+ fatal("Invalid signal %d", signal);
+ }
+
+ chains[signal].RemoveSpecialHandler(fn);
+}
+
+extern "C" void EnsureFrontOfChain(int signal) {
+ if (signal <= 0 || signal >= _NSIG) {
+ fatal("Invalid signal %d", signal);
+ }
+
+ // Read the current action without looking at the chain, it should be the expected action.
+ struct sigaction current_action;
+ InitializeSignalChain();
+ linked_sigaction(signal, nullptr, ¤t_action);
+ // If the sigactions don't match then we put the current action on the chain and make ourself as
+ // the main action.
+ if (current_action.sa_sigaction != SignalChain::Handler) {
+ log("Warning: Unexpected sigaction action found %p\n", current_action.sa_sigaction);
+ chains[signal].Register(signal);
}
}
diff --git a/sigchainlib/sigchain.h b/sigchainlib/sigchain.h
index 01ccedf..960d221 100644
--- a/sigchainlib/sigchain.h
+++ b/sigchainlib/sigchain.h
@@ -23,16 +23,11 @@
extern "C" void InitializeSignalChain();
-extern "C" void ClaimSignalChain(int signal, struct sigaction* oldaction);
-
-extern "C" void UnclaimSignalChain(int signal);
-
typedef bool (*SpecialSignalHandlerFn)(int, siginfo_t*, void*);
-extern "C" void SetSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn);
+extern "C" void AddSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn);
+extern "C" void RemoveSpecialSignalHandlerFn(int signal, SpecialSignalHandlerFn fn);
-extern "C" void InvokeUserSignalHandler(int sig, siginfo_t* info, void* context);
-
-extern "C" void EnsureFrontOfChain(int signal, struct sigaction* expected_action);
+extern "C" void EnsureFrontOfChain(int signal);
} // namespace art
diff --git a/sigchainlib/sigchain_dummy.cc b/sigchainlib/sigchain_dummy.cc
index aa3c360..d6a5e12 100644
--- a/sigchainlib/sigchain_dummy.cc
+++ b/sigchainlib/sigchain_dummy.cc
@@ -48,37 +48,23 @@
namespace art {
-
-extern "C" void ClaimSignalChain(int signal ATTRIBUTE_UNUSED,
- struct sigaction* oldaction ATTRIBUTE_UNUSED) {
- log("ClaimSignalChain is not exported by the main executable.");
- abort();
-}
-
-extern "C" void UnclaimSignalChain(int signal ATTRIBUTE_UNUSED) {
- log("UnclaimSignalChain is not exported by the main executable.");
- abort();
-}
-
-extern "C" void InvokeUserSignalHandler(int sig ATTRIBUTE_UNUSED,
- siginfo_t* info ATTRIBUTE_UNUSED,
- void* context ATTRIBUTE_UNUSED) {
- log("InvokeUserSignalHandler is not exported by the main executable.");
- abort();
-}
-
extern "C" void InitializeSignalChain() {
log("InitializeSignalChain is not exported by the main executable.");
abort();
}
-extern "C" void EnsureFrontOfChain(int signal ATTRIBUTE_UNUSED,
- struct sigaction* expected_action ATTRIBUTE_UNUSED) {
+extern "C" void EnsureFrontOfChain(int signal ATTRIBUTE_UNUSED) {
log("EnsureFrontOfChain is not exported by the main executable.");
abort();
}
-extern "C" void SetSpecialSignalHandlerFn(int signal ATTRIBUTE_UNUSED,
+extern "C" void AddSpecialSignalHandlerFn(int signal ATTRIBUTE_UNUSED,
+ SpecialSignalHandlerFn fn ATTRIBUTE_UNUSED) {
+ log("SetSpecialSignalHandlerFn is not exported by the main executable.");
+ abort();
+}
+
+extern "C" void RemoveSpecialSignalHandlerFn(int signal ATTRIBUTE_UNUSED,
SpecialSignalHandlerFn fn ATTRIBUTE_UNUSED) {
log("SetSpecialSignalHandlerFn is not exported by the main executable.");
abort();
diff --git a/sigchainlib/version-script32.txt b/sigchainlib/version-script32.txt
index eec9103..f360efa 100644
--- a/sigchainlib/version-script32.txt
+++ b/sigchainlib/version-script32.txt
@@ -1,11 +1,9 @@
{
global:
- ClaimSignalChain;
- UnclaimSignalChain;
- InvokeUserSignalHandler;
InitializeSignalChain;
EnsureFrontOfChain;
- SetSpecialSignalHandlerFn;
+ AddSpecialSignalHandlerFn;
+ RemoveSpecialSignalHandlerFn;
bsd_signal;
sigaction;
signal;
diff --git a/sigchainlib/version-script64.txt b/sigchainlib/version-script64.txt
index 08c312e..319d1c6 100644
--- a/sigchainlib/version-script64.txt
+++ b/sigchainlib/version-script64.txt
@@ -1,11 +1,9 @@
{
global:
- ClaimSignalChain;
- UnclaimSignalChain;
- InvokeUserSignalHandler;
InitializeSignalChain;
EnsureFrontOfChain;
- SetSpecialSignalHandlerFn;
+ AddSpecialSignalHandlerFn;
+ RemoveSpecialSignalHandlerFn;
sigaction;
signal;
sigprocmask;
diff --git a/test/004-SignalTest/expected.txt b/test/004-SignalTest/expected.txt
index b3a0e1c..847b56f 100644
--- a/test/004-SignalTest/expected.txt
+++ b/test/004-SignalTest/expected.txt
@@ -3,4 +3,8 @@
Caught NullPointerException
Caught StackOverflowError
signal caught
+unblocked signal received
+unblocking blocked signal
+blocked signal received
+signal handler done
Signal test OK
diff --git a/test/004-SignalTest/signaltest.cc b/test/004-SignalTest/signaltest.cc
index 6dd6355..a58a075 100644
--- a/test/004-SignalTest/signaltest.cc
+++ b/test/004-SignalTest/signaltest.cc
@@ -18,13 +18,14 @@
#include <signal.h>
#include <stdio.h>
#include <stdlib.h>
+#include <string.h>
#include <sys/ucontext.h>
#include <unistd.h>
#include "base/macros.h"
static int signal_count;
-static const int kMaxSignal = 2;
+static const int kMaxSignal = 1;
#if defined(__i386__) || defined(__x86_64__)
#if defined(__APPLE__)
@@ -47,6 +48,17 @@
#endif
#endif
+#define BLOCKED_SIGNAL SIGUSR1
+#define UNBLOCKED_SIGNAL SIGUSR2
+
+static void blocked_signal(int sig ATTRIBUTE_UNUSED) {
+ printf("blocked signal received\n");
+}
+
+static void unblocked_signal(int sig ATTRIBUTE_UNUSED) {
+ printf("unblocked signal received\n");
+}
+
static void signalhandler(int sig ATTRIBUTE_UNUSED, siginfo_t* info ATTRIBUTE_UNUSED,
void* context) {
printf("signal caught\n");
@@ -54,6 +66,16 @@
if (signal_count > kMaxSignal) {
abort();
}
+
+ raise(UNBLOCKED_SIGNAL);
+ raise(BLOCKED_SIGNAL);
+ printf("unblocking blocked signal\n");
+
+ sigset_t mask;
+ sigemptyset(&mask);
+ sigaddset(&mask, BLOCKED_SIGNAL);
+ sigprocmask(SIG_UNBLOCK, &mask, nullptr);
+
#if defined(__arm__)
struct ucontext *uc = reinterpret_cast<struct ucontext*>(context);
struct sigcontext *sc = reinterpret_cast<struct sigcontext*>(&uc->uc_mcontext);
@@ -71,6 +93,8 @@
#else
UNUSED(context);
#endif
+
+ printf("signal handler done\n");
}
static struct sigaction oldaction;
@@ -78,13 +102,21 @@
extern "C" JNIEXPORT void JNICALL Java_Main_initSignalTest(JNIEnv*, jclass) {
struct sigaction action;
action.sa_sigaction = signalhandler;
- sigemptyset(&action.sa_mask);
+ sigfillset(&action.sa_mask);
+ sigdelset(&action.sa_mask, UNBLOCKED_SIGNAL);
action.sa_flags = SA_SIGINFO | SA_ONSTACK;
#if !defined(__APPLE__) && !defined(__mips__)
action.sa_restorer = nullptr;
#endif
sigaction(SIGSEGV, &action, &oldaction);
+ struct sigaction check;
+ sigaction(SIGSEGV, nullptr, &check);
+ if (memcmp(&action, &check, sizeof(action)) != 0) {
+ printf("sigaction returned different value\n");
+ }
+ signal(BLOCKED_SIGNAL, blocked_signal);
+ signal(UNBLOCKED_SIGNAL, unblocked_signal);
}
extern "C" JNIEXPORT void JNICALL Java_Main_terminateSignalTest(JNIEnv*, jclass) {
@@ -96,6 +128,12 @@
char *go_away_compiler = nullptr;
extern "C" JNIEXPORT jint JNICALL Java_Main_testSignal(JNIEnv*, jclass) {
+ // Unblock UNBLOCKED_SIGNAL.
+ sigset_t mask;
+ memset(&mask, 0, sizeof(mask));
+ sigaddset(&mask, UNBLOCKED_SIGNAL);
+ sigprocmask(SIG_UNBLOCK, &mask, nullptr);
+
#if defined(__arm__) || defined(__i386__) || defined(__aarch64__)
// On supported architectures we cause a real SEGV.
*go_away_compiler = 'a';
diff --git a/test/115-native-bridge/nativebridge.cc b/test/115-native-bridge/nativebridge.cc
index 41329af..f913cf6 100644
--- a/test/115-native-bridge/nativebridge.cc
+++ b/test/115-native-bridge/nativebridge.cc
@@ -395,20 +395,6 @@
#endif
#endif
-static bool cannot_be_blocked(int signum) {
- // These two sigs cannot be blocked anywhere.
- if ((signum == SIGKILL) || (signum == SIGSTOP)) {
- return true;
- }
-
- // The invalid rt_sig cannot be blocked.
- if (((signum >= 32) && (signum < SIGRTMIN)) || (signum > SIGRTMAX)) {
- return true;
- }
-
- return false;
-}
-
// A dummy special handler, continueing after the faulting location. This code comes from
// 004-SignalTest.
static bool nb_signalhandler(int sig, siginfo_t* info ATTRIBUTE_UNUSED, void* context) {
@@ -433,22 +419,6 @@
#endif
}
- // Before invoking this handler, all other unclaimed signals must be blocked.
- // We're trying to check the signal mask to verify its status here.
- sigset_t tmpset;
- sigemptyset(&tmpset);
- sigprocmask(SIG_SETMASK, nullptr, &tmpset);
- int other_claimed = (sig == SIGSEGV) ? SIGILL : SIGSEGV;
- for (int signum = 0; signum < NSIG; ++signum) {
- if (cannot_be_blocked(signum)) {
- continue;
- } else if ((sigismember(&tmpset, signum)) && (signum == other_claimed)) {
- printf("ERROR: The claimed signal %d is blocked\n", signum);
- } else if ((!sigismember(&tmpset, signum)) && (signum != other_claimed)) {
- printf("ERROR: The unclaimed signal %d is not blocked\n", signum);
- }
- }
-
// We handled this...
return true;
}
diff --git a/test/616-cha-abstract/src/Main.java b/test/616-cha-abstract/src/Main.java
index e1d7db1..b33f575 100644
--- a/test/616-cha-abstract/src/Main.java
+++ b/test/616-cha-abstract/src/Main.java
@@ -39,8 +39,8 @@
}
public class Main {
- static Main1 sMain1;
- static Main1 sMain2;
+ static Base sMain1;
+ static Base sMain2;
static boolean sIsOptimizing = true;
static boolean sHasJIT = true;
diff --git a/test/616-cha-interface-default/expected.txt b/test/616-cha-interface-default/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-interface-default/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-interface-default/info.txt b/test/616-cha-interface-default/info.txt
new file mode 100644
index 0000000..11baa1f
--- /dev/null
+++ b/test/616-cha-interface-default/info.txt
@@ -0,0 +1,2 @@
+Test for Class Hierarchy Analysis (CHA) on interface method.
+Test it under multidex configuration to check cross-dex inlining.
diff --git a/test/616-cha-interface-default/multidex.jpp b/test/616-cha-interface-default/multidex.jpp
new file mode 100644
index 0000000..b0d200e
--- /dev/null
+++ b/test/616-cha-interface-default/multidex.jpp
@@ -0,0 +1,3 @@
+Main:
+ @@com.android.jack.annotations.ForceInMainDex
+ class Main
diff --git a/test/616-cha-interface-default/run b/test/616-cha-interface-default/run
new file mode 100644
index 0000000..d8b4f0d
--- /dev/null
+++ b/test/616-cha-interface-default/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run without an app image to prevent the classes to be loaded at startup.
+exec ${RUN} "${@}" --no-app-image
diff --git a/test/616-cha-interface-default/src-multidex/Base.java b/test/616-cha-interface-default/src-multidex/Base.java
new file mode 100644
index 0000000..2cbcb50
--- /dev/null
+++ b/test/616-cha-interface-default/src-multidex/Base.java
@@ -0,0 +1,41 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+interface Base {
+ default public int foo(int i) {
+ if (i != 1) {
+ return -2;
+ }
+ return i + 10;
+ }
+
+ // Test default method that's not inlined.
+ default public int $noinline$bar() {
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ return -1;
+ }
+
+ default void printError(String msg) {
+ System.out.println(msg);
+ }
+}
diff --git a/test/616-cha-interface-default/src/Main.java b/test/616-cha-interface-default/src/Main.java
new file mode 100644
index 0000000..951607d
--- /dev/null
+++ b/test/616-cha-interface-default/src/Main.java
@@ -0,0 +1,176 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Main1 implements Base {
+}
+
+class Main2 extends Main1 {
+ public void foobar() {}
+}
+
+class Main3 implements Base {
+ public int foo(int i) {
+ if (i != 3) {
+ printError("error3");
+ }
+ return -(i + 10);
+ }
+}
+
+public class Main {
+ static Base sMain1;
+ static Base sMain2;
+ static Base sMain3;
+
+ static boolean sIsOptimizing = true;
+ static boolean sHasJIT = true;
+ static volatile boolean sOtherThreadStarted;
+
+ private static void assertSingleImplementation(Class<?> clazz, String method_name, boolean b) {
+ if (hasSingleImplementation(clazz, method_name) != b) {
+ System.out.println(clazz + "." + method_name +
+ " doesn't have single implementation value of " + b);
+ }
+ }
+
+ static int getValue(Class<?> cls) {
+ if (cls == Main1.class || cls == Main2.class) {
+ return 1;
+ }
+ return 3;
+ }
+
+ // sMain1.foo()/sMain2.foo() will be always be Base.foo() before Main3 is loaded/linked.
+ // So sMain1.foo() can be devirtualized to Base.foo() and be inlined.
+ // After Dummy.createMain3() which links in Main3, live testImplement() on stack
+ // should be deoptimized.
+ static void testImplement(boolean createMain3, boolean wait, boolean setHasJIT) {
+ if (setHasJIT) {
+ if (isInterpreted()) {
+ sHasJIT = false;
+ }
+ return;
+ }
+
+ if (createMain3 && (sIsOptimizing || sHasJIT)) {
+ assertIsManaged();
+ }
+
+ if (sMain1.foo(getValue(sMain1.getClass())) != 11) {
+ System.out.println("11 expected.");
+ }
+ if (sMain1.$noinline$bar() != -1) {
+ System.out.println("-1 expected.");
+ }
+ if (sMain2.foo(getValue(sMain2.getClass())) != 11) {
+ System.out.println("11 expected.");
+ }
+
+ if (createMain3) {
+ // Wait for the other thread to start.
+ while (!sOtherThreadStarted);
+ // Create an Main2 instance and assign it to sMain2.
+ // sMain1 is kept the same.
+ sMain3 = Dummy.createMain3();
+ // Wake up the other thread.
+ synchronized(Main.class) {
+ Main.class.notify();
+ }
+ } else if (wait) {
+ // This is the other thread.
+ synchronized(Main.class) {
+ sOtherThreadStarted = true;
+ // Wait for Main2 to be linked and deoptimization is triggered.
+ try {
+ Main.class.wait();
+ } catch (Exception e) {
+ }
+ }
+ }
+
+ // There should be a deoptimization here right after Main3 is linked by
+ // calling Dummy.createMain3(), even though sMain1 didn't change.
+ // The behavior here would be different if inline-cache is used, which
+ // doesn't deoptimize since sMain1 still hits the type cache.
+ if (sMain1.foo(getValue(sMain1.getClass())) != 11) {
+ System.out.println("11 expected.");
+ }
+ if ((createMain3 || wait) && sHasJIT && !sIsOptimizing) {
+ // This method should be deoptimized right after Main3 is created.
+ assertIsInterpreted();
+ }
+
+ if (sMain3 != null) {
+ if (sMain3.foo(getValue(sMain3.getClass())) != -13) {
+ System.out.println("-13 expected.");
+ }
+ }
+ }
+
+ // Test scenarios under which CHA-based devirtualization happens,
+ // and class loading that implements a method can invalidate compiled code.
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+
+ if (isInterpreted()) {
+ sIsOptimizing = false;
+ }
+
+ // sMain1 is an instance of Main1.
+ // sMain2 is an instance of Main2.
+ // Neither Main1 nor Main2 override default method Base.foo().
+ // Main3 hasn't bee loaded yet.
+ sMain1 = new Main1();
+ sMain2 = new Main2();
+
+ ensureJitCompiled(Main.class, "testImplement");
+ testImplement(false, false, true);
+
+ if (sHasJIT && !sIsOptimizing) {
+ assertSingleImplementation(Base.class, "foo", true);
+ assertSingleImplementation(Main1.class, "foo", true);
+ } else {
+ // Main3 is verified ahead-of-time so it's linked in already.
+ }
+
+ // Create another thread that also calls sMain1.foo().
+ // Try to test suspend and deopt another thread.
+ new Thread() {
+ public void run() {
+ testImplement(false, true, false);
+ }
+ }.start();
+
+ // This will create Main3 instance in the middle of testImplement().
+ testImplement(true, false, false);
+ assertSingleImplementation(Base.class, "foo", false);
+ assertSingleImplementation(Main1.class, "foo", true);
+ assertSingleImplementation(sMain3.getClass(), "foo", true);
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+ private static native void assertIsInterpreted();
+ private static native void assertIsManaged();
+ private static native boolean isInterpreted();
+ private static native boolean hasSingleImplementation(Class<?> clazz, String method_name);
+}
+
+// Put createMain3() in another class to avoid class loading due to verifier.
+class Dummy {
+ static Base createMain3() {
+ return new Main3();
+ }
+}
diff --git a/test/616-cha-interface/expected.txt b/test/616-cha-interface/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-interface/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-interface/info.txt b/test/616-cha-interface/info.txt
new file mode 100644
index 0000000..1fd330a
--- /dev/null
+++ b/test/616-cha-interface/info.txt
@@ -0,0 +1 @@
+Test for Class Hierarchy Analysis (CHA) on interface method.
diff --git a/test/616-cha-interface/run b/test/616-cha-interface/run
new file mode 100644
index 0000000..d8b4f0d
--- /dev/null
+++ b/test/616-cha-interface/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run without an app image to prevent the classes to be loaded at startup.
+exec ${RUN} "${@}" --no-app-image
diff --git a/test/616-cha-interface/src/Main.java b/test/616-cha-interface/src/Main.java
new file mode 100644
index 0000000..3c93496
--- /dev/null
+++ b/test/616-cha-interface/src/Main.java
@@ -0,0 +1,173 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+interface Base {
+ void foo(int i);
+ void $noinline$bar();
+}
+
+class Main1 implements Base {
+ public void foo(int i) {
+ if (i != 1) {
+ printError("error1");
+ }
+ }
+
+ // Test rewriting invoke-interface into invoke-virtual when inlining fails.
+ public void $noinline$bar() {
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ System.out.print("");
+ }
+
+ void printError(String msg) {
+ System.out.println(msg);
+ }
+}
+
+class Main2 extends Main1 {
+ public void foo(int i) {
+ if (i != 2) {
+ printError("error2");
+ }
+ }
+}
+
+public class Main {
+ static Base sMain1;
+ static Base sMain2;
+
+ static boolean sIsOptimizing = true;
+ static boolean sHasJIT = true;
+ static volatile boolean sOtherThreadStarted;
+
+ private static void assertSingleImplementation(Class<?> clazz, String method_name, boolean b) {
+ if (hasSingleImplementation(clazz, method_name) != b) {
+ System.out.println(clazz + "." + method_name +
+ " doesn't have single implementation value of " + b);
+ }
+ }
+
+ // sMain1.foo() will be always be Main1.foo() before Main2 is loaded/linked.
+ // So sMain1.foo() can be devirtualized to Main1.foo() and be inlined.
+ // After Dummy.createMain2() which links in Main2, live testImplement() on stack
+ // should be deoptimized.
+ static void testImplement(boolean createMain2, boolean wait, boolean setHasJIT) {
+ if (setHasJIT) {
+ if (isInterpreted()) {
+ sHasJIT = false;
+ }
+ return;
+ }
+
+ if (createMain2 && (sIsOptimizing || sHasJIT)) {
+ assertIsManaged();
+ }
+
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+ sMain1.$noinline$bar();
+
+ if (createMain2) {
+ // Wait for the other thread to start.
+ while (!sOtherThreadStarted);
+ // Create an Main2 instance and assign it to sMain2.
+ // sMain1 is kept the same.
+ sMain2 = Dummy.createMain2();
+ // Wake up the other thread.
+ synchronized(Main.class) {
+ Main.class.notify();
+ }
+ } else if (wait) {
+ // This is the other thread.
+ synchronized(Main.class) {
+ sOtherThreadStarted = true;
+ // Wait for Main2 to be linked and deoptimization is triggered.
+ try {
+ Main.class.wait();
+ } catch (Exception e) {
+ }
+ }
+ }
+
+ // There should be a deoptimization here right after Main2 is linked by
+ // calling Dummy.createMain2(), even though sMain1 didn't change.
+ // The behavior here would be different if inline-cache is used, which
+ // doesn't deoptimize since sMain1 still hits the type cache.
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+ if ((createMain2 || wait) && sHasJIT && !sIsOptimizing) {
+ // This method should be deoptimized right after Main2 is created.
+ assertIsInterpreted();
+ }
+
+ if (sMain2 != null) {
+ sMain2.foo(sMain2.getClass() == Main1.class ? 1 : 2);
+ }
+ }
+
+ // Test scenarios under which CHA-based devirtualization happens,
+ // and class loading that overrides a method can invalidate compiled code.
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+
+ if (isInterpreted()) {
+ sIsOptimizing = false;
+ }
+
+ // sMain1 is an instance of Main1. Main2 hasn't bee loaded yet.
+ sMain1 = new Main1();
+
+ ensureJitCompiled(Main.class, "testImplement");
+ testImplement(false, false, true);
+
+ if (sHasJIT && !sIsOptimizing) {
+ assertSingleImplementation(Base.class, "foo", true);
+ assertSingleImplementation(Main1.class, "foo", true);
+ } else {
+ // Main2 is verified ahead-of-time so it's linked in already.
+ }
+
+ // Create another thread that also calls sMain1.foo().
+ // Try to test suspend and deopt another thread.
+ new Thread() {
+ public void run() {
+ testImplement(false, true, false);
+ }
+ }.start();
+
+ // This will create Main2 instance in the middle of testImplement().
+ testImplement(true, false, false);
+ assertSingleImplementation(Base.class, "foo", false);
+ assertSingleImplementation(Main1.class, "foo", false);
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+ private static native void assertIsInterpreted();
+ private static native void assertIsManaged();
+ private static native boolean isInterpreted();
+ private static native boolean hasSingleImplementation(Class<?> clazz, String method_name);
+}
+
+// Put createMain2() in another class to avoid class loading due to verifier.
+class Dummy {
+ static Main1 createMain2() {
+ return new Main2();
+ }
+}
diff --git a/test/616-cha-miranda/expected.txt b/test/616-cha-miranda/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-miranda/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-miranda/info.txt b/test/616-cha-miranda/info.txt
new file mode 100644
index 0000000..c46f33f
--- /dev/null
+++ b/test/616-cha-miranda/info.txt
@@ -0,0 +1 @@
+Test for Class Hierarchy Analysis (CHA) on miranda method.
diff --git a/test/616-cha-miranda/run b/test/616-cha-miranda/run
new file mode 100644
index 0000000..d8b4f0d
--- /dev/null
+++ b/test/616-cha-miranda/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run without an app image to prevent the classes to be loaded at startup.
+exec ${RUN} "${@}" --no-app-image
diff --git a/test/616-cha-miranda/src/Main.java b/test/616-cha-miranda/src/Main.java
new file mode 100644
index 0000000..e548482
--- /dev/null
+++ b/test/616-cha-miranda/src/Main.java
@@ -0,0 +1,163 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+interface Iface {
+ public void foo(int i);
+}
+
+abstract class Base implements Iface {
+ // Iface.foo(int) will be added as a miranda method.
+
+ void printError(String msg) {
+ System.out.println(msg);
+ }
+}
+
+class Main1 extends Base {
+ public void foo(int i) {
+ if (i != 1) {
+ printError("error1");
+ }
+ }
+}
+
+class Main2 extends Main1 {
+ public void foo(int i) {
+ if (i != 2) {
+ printError("error2");
+ }
+ }
+}
+
+public class Main {
+ static Base sMain1;
+ static Base sMain2;
+
+ static boolean sIsOptimizing = true;
+ static boolean sHasJIT = true;
+ static volatile boolean sOtherThreadStarted;
+
+ private static void assertSingleImplementation(Class<?> clazz, String method_name, boolean b) {
+ if (hasSingleImplementation(clazz, method_name) != b) {
+ System.out.println(clazz + "." + method_name +
+ " doesn't have single implementation value of " + b);
+ }
+ }
+
+ // sMain1.foo() will be always be Main1.foo() before Main2 is loaded/linked.
+ // So sMain1.foo() can be devirtualized to Main1.foo() and be inlined.
+ // After Dummy.createMain2() which links in Main2, live testOverride() on stack
+ // should be deoptimized.
+ static void testOverride(boolean createMain2, boolean wait, boolean setHasJIT) {
+ if (setHasJIT) {
+ if (isInterpreted()) {
+ sHasJIT = false;
+ }
+ return;
+ }
+
+ if (createMain2 && (sIsOptimizing || sHasJIT)) {
+ assertIsManaged();
+ }
+
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+
+ if (createMain2) {
+ // Wait for the other thread to start.
+ while (!sOtherThreadStarted);
+ // Create an Main2 instance and assign it to sMain2.
+ // sMain1 is kept the same.
+ sMain2 = Dummy.createMain2();
+ // Wake up the other thread.
+ synchronized(Main.class) {
+ Main.class.notify();
+ }
+ } else if (wait) {
+ // This is the other thread.
+ synchronized(Main.class) {
+ sOtherThreadStarted = true;
+ // Wait for Main2 to be linked and deoptimization is triggered.
+ try {
+ Main.class.wait();
+ } catch (Exception e) {
+ }
+ }
+ }
+
+ // There should be a deoptimization here right after Main2 is linked by
+ // calling Dummy.createMain2(), even though sMain1 didn't change.
+ // The behavior here would be different if inline-cache is used, which
+ // doesn't deoptimize since sMain1 still hits the type cache.
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+ if ((createMain2 || wait) && sHasJIT && !sIsOptimizing) {
+ // This method should be deoptimized right after Main2 is created.
+ assertIsInterpreted();
+ }
+
+ if (sMain2 != null) {
+ sMain2.foo(sMain2.getClass() == Main1.class ? 1 : 2);
+ }
+ }
+
+ // Test scenarios under which CHA-based devirtualization happens,
+ // and class loading that overrides a method can invalidate compiled code.
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+
+ if (isInterpreted()) {
+ sIsOptimizing = false;
+ }
+
+ // sMain1 is an instance of Main1. Main2 hasn't bee loaded yet.
+ sMain1 = new Main1();
+
+ ensureJitCompiled(Main.class, "testOverride");
+ testOverride(false, false, true);
+
+ if (sHasJIT && !sIsOptimizing) {
+ assertSingleImplementation(Base.class, "foo", true);
+ assertSingleImplementation(Main1.class, "foo", true);
+ } else {
+ // Main2 is verified ahead-of-time so it's linked in already.
+ }
+
+ // Create another thread that also calls sMain1.foo().
+ // Try to test suspend and deopt another thread.
+ new Thread() {
+ public void run() {
+ testOverride(false, true, false);
+ }
+ }.start();
+
+ // This will create Main2 instance in the middle of testOverride().
+ testOverride(true, false, false);
+ assertSingleImplementation(Base.class, "foo", false);
+ assertSingleImplementation(Main1.class, "foo", false);
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+ private static native void assertIsInterpreted();
+ private static native void assertIsManaged();
+ private static native boolean isInterpreted();
+ private static native boolean hasSingleImplementation(Class<?> clazz, String method_name);
+}
+
+// Put createMain2() in another class to avoid class loading due to verifier.
+class Dummy {
+ static Main1 createMain2() {
+ return new Main2();
+ }
+}
diff --git a/test/616-cha-proxy-method-inline/expected.txt b/test/616-cha-proxy-method-inline/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-proxy-method-inline/info.txt b/test/616-cha-proxy-method-inline/info.txt
new file mode 100644
index 0000000..0126855
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/info.txt
@@ -0,0 +1 @@
+Test for Class Hierarchy Analysis (CHA) on inlining a cross-dex proxy method.
diff --git a/test/616-cha-proxy-method-inline/multidex.jpp b/test/616-cha-proxy-method-inline/multidex.jpp
new file mode 100644
index 0000000..b0d200e
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/multidex.jpp
@@ -0,0 +1,3 @@
+Main:
+ @@com.android.jack.annotations.ForceInMainDex
+ class Main
diff --git a/test/616-cha-proxy-method-inline/run b/test/616-cha-proxy-method-inline/run
new file mode 100644
index 0000000..d8b4f0d
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run without an app image to prevent the classes to be loaded at startup.
+exec ${RUN} "${@}" --no-app-image
diff --git a/test/616-cha-proxy-method-inline/src-multidex/Foo.java b/test/616-cha-proxy-method-inline/src-multidex/Foo.java
new file mode 100644
index 0000000..9deca3e
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/src-multidex/Foo.java
@@ -0,0 +1,19 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+interface Foo {
+ public Object bar(Object obj);
+}
diff --git a/test/616-cha-proxy-method-inline/src/Main.java b/test/616-cha-proxy-method-inline/src/Main.java
new file mode 100644
index 0000000..be7bc82
--- /dev/null
+++ b/test/616-cha-proxy-method-inline/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+import java.lang.reflect.InvocationTargetException;
+
+class DebugProxy implements java.lang.reflect.InvocationHandler {
+ private Object obj;
+ static Class<?>[] interfaces = {Foo.class};
+
+ public static Object newInstance(Object obj) {
+ return java.lang.reflect.Proxy.newProxyInstance(
+ Foo.class.getClassLoader(),
+ interfaces,
+ new DebugProxy(obj));
+ }
+
+ private DebugProxy(Object obj) {
+ this.obj = obj;
+ }
+
+ public Object invoke(Object proxy, Method m, Object[] args) throws Throwable {
+ Object result;
+ if (obj == null) {
+ return null;
+ }
+ try {
+ System.out.println("before invoking method " + m.getName());
+ result = m.invoke(obj, args);
+ } catch (InvocationTargetException e) {
+ throw e.getTargetException();
+ } catch (Exception e) {
+ throw new RuntimeException("unexpected invocation exception: " + e.getMessage());
+ } finally {
+ System.out.println("after invoking method " + m.getName());
+ }
+ return result;
+ }
+}
+
+public class Main {
+ public static void call(Foo foo) {
+ if (foo == null) {
+ return;
+ }
+ foo.bar(null);
+ }
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+ Foo foo = (Foo)DebugProxy.newInstance(null);
+ ensureJitCompiled(Main.class, "call");
+ call(foo);
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+}
diff --git a/test/644-checker-deopt/expected.txt b/test/644-checker-deopt/expected.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/644-checker-deopt/expected.txt
diff --git a/test/644-checker-deopt/info.txt b/test/644-checker-deopt/info.txt
new file mode 100644
index 0000000..c5fb12c
--- /dev/null
+++ b/test/644-checker-deopt/info.txt
@@ -0,0 +1,2 @@
+Regression test for making sure HDeoptimize is executed before
+the code it should have prevented executing.
diff --git a/test/644-checker-deopt/profile b/test/644-checker-deopt/profile
new file mode 100644
index 0000000..cb261cc
--- /dev/null
+++ b/test/644-checker-deopt/profile
@@ -0,0 +1,2 @@
+LMain;->inlineMonomorphic(LMain;)I+LMain;
+LMain;->inlinePolymorphic(LMain;)I+LMain;,LSubMain;
diff --git a/test/644-checker-deopt/run b/test/644-checker-deopt/run
new file mode 100644
index 0000000..146e180
--- /dev/null
+++ b/test/644-checker-deopt/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+exec ${RUN} $@ --profile -Xcompiler-option --compiler-filter=speed-profile
diff --git a/test/644-checker-deopt/src/Main.java b/test/644-checker-deopt/src/Main.java
new file mode 100644
index 0000000..17c80a6
--- /dev/null
+++ b/test/644-checker-deopt/src/Main.java
@@ -0,0 +1,74 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) inliner (before)
+ /// CHECK: InvokeVirtual method_name:Main.getValue
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) inliner (after)
+ /// CHECK-NOT: InvokeVirtual method_name:Main.getValue
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) licm (before)
+ /// CHECK: <<Deopt:l\d+>> Deoptimize
+ /// CHECK: InstanceFieldGet [<<Deopt>>] field_name:Main.value
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) licm (after)
+ /// CHECK: <<Deopt:l\d+>> Deoptimize
+ /// CHECK: InstanceFieldGet [<<Deopt>>] field_name:Main.value
+
+ public static int inlineMonomorphic(Main a) {
+ if (a == null) {
+ return 42;
+ }
+ int i = 0;
+ while (i < 100) {
+ i += a.getValue();
+ }
+ return i;
+ }
+
+ /// CHECK-START: int Main.inlinePolymorphic(Main) inliner (before)
+ /// CHECK: InvokeVirtual method_name:Main.getValue
+
+ /// CHECK-START: int Main.inlinePolymorphic(Main) inliner (after)
+ /// CHECK-NOT: InvokeVirtual method_name:Main.getValue
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) licm (before)
+ /// CHECK: <<Deopt:l\d+>> Deoptimize
+ /// CHECK: InstanceFieldGet [<<Deopt>>] field_name:Main.value
+
+ /// CHECK-START: int Main.inlineMonomorphic(Main) licm (after)
+ /// CHECK: <<Deopt:l\d+>> Deoptimize
+ /// CHECK: InstanceFieldGet [<<Deopt>>] field_name:Main.value
+ public static int inlinePolymorphic(Main a) {
+ return a.getValue();
+ }
+
+ public int getValue() {
+ return value;
+ }
+
+ public static void main(String[] args) {
+ inlineMonomorphic(new Main());
+ }
+
+ int value = 1;
+}
+
+// Add a subclass of 'Main' to write the polymorphic inline cache in the profile.
+class SubMain extends Main {
+}
diff --git a/test/901-hello-ti-agent/basics.cc b/test/901-hello-ti-agent/basics.cc
index 9166277..cbd7686 100644
--- a/test/901-hello-ti-agent/basics.cc
+++ b/test/901-hello-ti-agent/basics.cc
@@ -16,6 +16,8 @@
#include "901-hello-ti-agent/basics.h"
+#include <thread>
+
#include <jni.h>
#include <stdio.h>
#include <string.h>
@@ -159,5 +161,19 @@
return (current_phase == JVMTI_PHASE_LIVE) ? JNI_TRUE : JNI_FALSE;
}
+static void CallJvmtiFunction(jvmtiEnv* env, jclass klass, jvmtiError* err) {
+ jint n;
+ jmethodID* methods = nullptr;
+ *err = env->GetClassMethods(klass, &n, &methods);
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_checkUnattached(
+ JNIEnv* env ATTRIBUTE_UNUSED, jclass Main_klass) {
+ jvmtiError res = JVMTI_ERROR_NONE;
+ std::thread t1(CallJvmtiFunction, jvmti_env, Main_klass, &res);
+ t1.join();
+ return res == JVMTI_ERROR_UNATTACHED_THREAD;
+}
+
} // namespace Test901HelloTi
} // namespace art
diff --git a/test/901-hello-ti-agent/expected.txt b/test/901-hello-ti-agent/expected.txt
index c4b24cb..eb5b6a2 100644
--- a/test/901-hello-ti-agent/expected.txt
+++ b/test/901-hello-ti-agent/expected.txt
@@ -3,6 +3,7 @@
VMInit
Hello, world!
Agent in live phase.
+Received expected error for unattached JVMTI calls
0
1
2
diff --git a/test/901-hello-ti-agent/src/Main.java b/test/901-hello-ti-agent/src/Main.java
index 4d62ed3..556e05b 100644
--- a/test/901-hello-ti-agent/src/Main.java
+++ b/test/901-hello-ti-agent/src/Main.java
@@ -21,6 +21,9 @@
if (checkLivePhase()) {
System.out.println("Agent in live phase.");
}
+ if (checkUnattached()) {
+ System.out.println("Received expected error for unattached JVMTI calls");
+ }
set(0); // OTHER
set(1); // GC
@@ -41,4 +44,5 @@
private static native boolean checkLivePhase();
private static native void setVerboseFlag(int flag, boolean value);
+ private static native boolean checkUnattached();
}
diff --git a/test/931-agent-thread/agent_thread.cc b/test/931-agent-thread/agent_thread.cc
index f8f9e48..2e6bd46 100644
--- a/test/931-agent-thread/agent_thread.cc
+++ b/test/931-agent-thread/agent_thread.cc
@@ -36,7 +36,8 @@
struct AgentData {
AgentData() : main_thread(nullptr),
jvmti_env(nullptr),
- b(2) {
+ b(2),
+ priority(0) {
}
jthread main_thread;
diff --git a/test/981-dedup-original-dex/expected.txt b/test/981-dedup-original-dex/expected.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/981-dedup-original-dex/expected.txt
diff --git a/test/981-dedup-original-dex/info.txt b/test/981-dedup-original-dex/info.txt
new file mode 100644
index 0000000..62696e0
--- /dev/null
+++ b/test/981-dedup-original-dex/info.txt
@@ -0,0 +1,4 @@
+Tests basic functions in the jvmti plugin.
+
+This checks that we do not needlessly duplicate the contents of retransformed
+classes original dex files.
diff --git a/test/981-dedup-original-dex/run b/test/981-dedup-original-dex/run
new file mode 100755
index 0000000..e92b873
--- /dev/null
+++ b/test/981-dedup-original-dex/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/981-dedup-original-dex/src/Main.java b/test/981-dedup-original-dex/src/Main.java
new file mode 100644
index 0000000..cd3f007
--- /dev/null
+++ b/test/981-dedup-original-dex/src/Main.java
@@ -0,0 +1,139 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Field;
+import java.util.Base64;
+
+import dalvik.system.ClassExt;
+
+public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_1 = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform2 {
+ * public void sayHi() {
+ * System.out.println("Goodbye2");
+ * }
+ * }
+ */
+ private static final byte[] DEX_BYTES_2 = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAjXDED2iflQ3NXbPtBRVjQVMqoDU9nDz/QAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+ "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
+ "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
+ "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+ "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
+ "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
+ "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+ "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+ "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
+
+ public static void main(String[] args) {
+ try {
+ doTest();
+ } catch (Exception e) {
+ e.printStackTrace();
+ }
+ }
+
+ private static void assertSame(Object a, Object b) throws Exception {
+ if (a != b) {
+ throw new AssertionError("'" + (a != null ? a.toString() : "null") + "' is not the same as " +
+ "'" + (b != null ? b.toString() : "null") + "'");
+ }
+ }
+
+ private static Object getObjectField(Object o, String name) throws Exception {
+ return getObjectField(o, o.getClass(), name);
+ }
+
+ private static Object getObjectField(Object o, Class<?> type, String name) throws Exception {
+ Field f = type.getDeclaredField(name);
+ f.setAccessible(true);
+ return f.get(o);
+ }
+
+ private static Object getOriginalDexFile(Class<?> k) throws Exception {
+ ClassExt ext_data_object = (ClassExt) getObjectField(k, "extData");
+ if (ext_data_object == null) {
+ return null;
+ }
+
+ return getObjectField(ext_data_object, "originalDexFile");
+ }
+
+ public static void doTest() throws Exception {
+ // Make sure both of these are loaded prior to transformations being added so they have the same
+ // original dex files.
+ Transform t1 = new Transform();
+ Transform2 t2 = new Transform2();
+
+ assertSame(null, getOriginalDexFile(t1.getClass()));
+ assertSame(null, getOriginalDexFile(t2.getClass()));
+ assertSame(null, getOriginalDexFile(Main.class));
+
+ addCommonTransformationResult("Transform", new byte[0], DEX_BYTES_1);
+ addCommonTransformationResult("Transform2", new byte[0], DEX_BYTES_2);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class, Transform2.class);
+
+ assertSame(getOriginalDexFile(t1.getClass()), getOriginalDexFile(t2.getClass()));
+ assertSame(null, getOriginalDexFile(Main.class));
+ // Make sure that the original dex file is a DexCache object.
+ assertSame(getOriginalDexFile(t1.getClass()).getClass(), Class.forName("java.lang.DexCache"));
+
+ // Check that we end up with a byte[] if we do a direct RedefineClasses
+ enableCommonRetransformation(false);
+ doCommonClassRedefinition(Transform.class, new byte[0], DEX_BYTES_1);
+ assertSame((new byte[0]).getClass(), getOriginalDexFile(t1.getClass()).getClass());
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/981-dedup-original-dex/src/Transform.java b/test/981-dedup-original-dex/src/Transform.java
new file mode 100644
index 0000000..3c97907
--- /dev/null
+++ b/test/981-dedup-original-dex/src/Transform.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ System.out.println("hello");
+ }
+}
diff --git a/test/981-dedup-original-dex/src/Transform2.java b/test/981-dedup-original-dex/src/Transform2.java
new file mode 100644
index 0000000..eb22842
--- /dev/null
+++ b/test/981-dedup-original-dex/src/Transform2.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform2 {
+ public void sayHi() {
+ System.out.println("hello2");
+ }
+}
diff --git a/test/982-ok-no-retransform/expected.txt b/test/982-ok-no-retransform/expected.txt
new file mode 100644
index 0000000..317e967
--- /dev/null
+++ b/test/982-ok-no-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+hello
diff --git a/test/982-ok-no-retransform/info.txt b/test/982-ok-no-retransform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/982-ok-no-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/982-ok-no-retransform/run b/test/982-ok-no-retransform/run
new file mode 100755
index 0000000..c6e62ae
--- /dev/null
+++ b/test/982-ok-no-retransform/run
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --jvmti
diff --git a/test/982-ok-no-retransform/src/Main.java b/test/982-ok-no-retransform/src/Main.java
new file mode 100644
index 0000000..7bb4a46
--- /dev/null
+++ b/test/982-ok-no-retransform/src/Main.java
@@ -0,0 +1,34 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ public static void main(String[] args) {
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ t.sayHi();
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+}
diff --git a/test/982-ok-no-retransform/src/Transform.java b/test/982-ok-no-retransform/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/982-ok-no-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index 703b911..cc015b0 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -138,6 +138,7 @@
# specific version depending on the compiler.
ART_TEST_HOST_RUN_TEST_DEPENDENCIES := \
$(ART_HOST_EXECUTABLES) \
+ $(HOST_OUT_EXECUTABLES)/hprof-conv \
$(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libtiagent) \
$(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libtiagentd) \
$(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libartagent) \
@@ -177,8 +178,6 @@
# Required for dx, jasmin, smali, dexmerger, jack.
host_prereq_rules += $(TEST_ART_RUN_TEST_DEPENDENCIES)
-host_prereq_rules += $(HOST_OUT_EXECUTABLES)/hprof-conv
-
# Classpath for Jack compilation for target.
target_prereq_rules := $(TARGET_JACK_CLASSPATH_DEPENDENCIES)
@@ -225,18 +224,6 @@
test-art-target-run-test-dependencies : $(target_prereq_rules)
test-art-run-test-dependencies : test-art-host-run-test-dependencies test-art-target-run-test-dependencies
-# Generate list of dependencies required for given target - HOST or TARGET, IMAGE_TYPE,
-# COMPILER_TYPE and ADDRESS_SIZE.
-$(foreach target, $(TARGET_TYPES), \
- $(foreach image, $(IMAGE_TYPES), \
- $(foreach compiler, $(COMPILER_TYPES), \
- $(foreach address_size, $(ALL_ADDRESS_SIZES), $(eval \
- $(call core-image-dependencies,$(target),$(image),$(compiler),$(address_size)))))))
-
-test-art-host-run-test-dependencies : $(host_prereq_rules)
-test-art-target-run-test-dependencies : $(target_prereq_rules)
-test-art-run-test-dependencies : test-art-host-run-test-dependencies test-art-target-run-test-dependencies
-
# Create a rule to build and run a test group of the following form:
# test-art-{1: host target}-run-test
define define-test-art-host-or-target-run-test-group
@@ -259,8 +246,6 @@
target_prereq_rules :=
core-image-dependencies :=
name-to-var :=
-ART_TEST_HOST_RUN_TEST_DEPENDENCIES :=
-TEST_ART_TARGET_SYNC_DEPS :=
define-test-art-host-or-target-run-test-group :=
TARGET_TYPES :=
COMPILER_TYPES :=
diff --git a/test/knownfailures.json b/test/knownfailures.json
index 2de34ca..8aa0c55 100644
--- a/test/knownfailures.json
+++ b/test/knownfailures.json
@@ -332,8 +332,12 @@
{
"tests": ["912-classes",
"616-cha",
- "616-cha-abstract"],
- "bug": "http://b/36344364 http://b36344221",
+ "616-cha-abstract",
+ "616-cha-interface",
+ "616-cha-interface-default",
+ "616-cha-miranda",
+ "616-cha-proxy-method-inline"],
+ "bug": "http://b/36344364 http://b/36344221",
"variant": "no-dex2oat | relocate-npatchoat"
},
{
@@ -358,9 +362,9 @@
"variant": "interp-ac"
},
{
- "tests": "638-checker-inline-caches",
- "description": ["Disable 638-checker-inline-caches temporarily until a fix",
- "arrives."],
+ "tests": ["638-checker-inline-caches",
+ "644-checker-deopt"],
+ "description": ["Disabled temporarily until a fix arrives."],
"bug": "http://b/36371709"
}
]
diff --git a/test/testrunner/run_build_test_target.py b/test/testrunner/run_build_test_target.py
index 835b678..282ac48 100755
--- a/test/testrunner/run_build_test_target.py
+++ b/test/testrunner/run_build_test_target.py
@@ -51,7 +51,10 @@
build_command += ' -j' + str(n_threads)
build_command += ' -C ' + env.ANDROID_BUILD_TOP
build_command += ' ' + target.get('target')
- print build_command.split()
+ # Add 'dist' to avoid Jack issues b/36169180.
+ build_command += ' dist'
+ sys.stdout.write(str(build_command))
+ sys.stdout.flush()
if subprocess.call(build_command.split()):
sys.exit(1)
@@ -64,7 +67,8 @@
run_test_command += ['--host']
run_test_command += ['--verbose']
- print run_test_command
+ sys.stdout.write(str(run_test_command))
+ sys.stdout.flush()
if subprocess.call(run_test_command):
sys.exit(1)
diff --git a/test/testrunner/testrunner.py b/test/testrunner/testrunner.py
index 3203f7a..149578d 100755
--- a/test/testrunner/testrunner.py
+++ b/test/testrunner/testrunner.py
@@ -53,6 +53,7 @@
import re
import subprocess
import sys
+import tempfile
import threading
import time
@@ -433,8 +434,10 @@
options_test += ' --instruction-set-features ' + \
env.HOST_2ND_ARCH_PREFIX_DEX2OAT_HOST_INSTRUCTION_SET_FEATURES
- options_test = (' --output-path %s/run-test-output/%s') % (
- env.ART_HOST_TEST_DIR, test_name) + options_test
+ # TODO(http://36039166): This is a temporary solution to
+ # fix build breakages.
+ options_test = (' --output-path %s') % (
+ tempfile.mkdtemp(dir=env.ART_HOST_TEST_DIR)) + options_test
run_test_sh = env.ANDROID_BUILD_TOP + '/art/test/run-test'
command = run_test_sh + ' ' + options_test + ' ' + test
@@ -480,7 +483,7 @@
if test_passed:
print_test_info(test_name, 'PASS')
else:
- failed_tests.append(test_name)
+ failed_tests.append((test_name, script_output))
if not env.ART_TEST_KEEP_GOING:
stop_testrunner = True
print_test_info(test_name, 'FAIL', ('%s\n%s') % (
@@ -491,13 +494,13 @@
else:
print_test_info(test_name, '')
except subprocess.TimeoutExpired as e:
- failed_tests.append(test_name)
- print_test_info(test_name, 'TIMEOUT', 'timed out in %d\n%s' % (
+ failed_tests.append((test_name, 'Timed out in %d seconds'))
+ print_test_info(test_name, 'TIMEOUT', 'Timed out in %d seconds\n%s' % (
timeout, command))
except Exception as e:
- failed_tests.append(test_name)
- print_test_info(test_name, 'FAIL')
- print_text(('%s\n%s\n\n') % (command, str(e)))
+ failed_tests.append((test_name, str(e)))
+ print_test_info(test_name, 'FAIL',
+ ('%s\n%s\n\n') % (command, str(e)))
finally:
semaphore.release()
@@ -711,16 +714,16 @@
# Prints the list of skipped tests, if any.
if skipped_tests:
- print_text(COLOR_SKIP + 'SKIPPED TESTS' + COLOR_NORMAL + '\n')
+ print_text(COLOR_SKIP + 'SKIPPED TESTS: ' + COLOR_NORMAL + '\n')
for test in skipped_tests:
print_text(test + '\n')
print_text('\n')
# Prints the list of failed tests, if any.
if failed_tests:
- print_text(COLOR_ERROR + 'FAILED TESTS' + COLOR_NORMAL + '\n')
- for test in failed_tests:
- print_text(test + '\n')
+ print_text(COLOR_ERROR + 'FAILED: ' + COLOR_NORMAL + '\n')
+ for test_info in failed_tests:
+ print_text(('%s\n%s\n' % (test_info[0], test_info[1])))
def parse_test_name(test_name):
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index fddae3a..68c7d50 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -121,6 +121,8 @@
{ "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
{ "944-transform-classloaders", common_redefine::OnLoad, nullptr },
{ "945-obsolete-native", common_redefine::OnLoad, nullptr },
+ { "981-dedup-original-dex", common_retransform::OnLoad, nullptr },
+ { "982-ok-no-retransform", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
