Merge "Use original dex file for retransformation."
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 0341c64..d98daa5 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -612,7 +612,7 @@
ClassExtOffsets() : CheckOffsets<mirror::ClassExt>(false, "Ldalvik/system/ClassExt;") {
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_dex_caches_), "obsoleteDexCaches");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_methods_), "obsoleteMethods");
- addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_cache_), "originalDexCache");
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_file_bytes_), "originalDexFile");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, verify_error_), "verifyError");
}
};
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index 7c6a710..efd949e 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -113,6 +113,11 @@
}
}
+void ClassExt::SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) {
+ DCHECK(!Runtime::Current()->IsActiveTransaction());
+ SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_), bytes);
+}
+
void ClassExt::SetClass(ObjPtr<Class> dalvik_system_ClassExt) {
CHECK(dalvik_system_ClassExt != nullptr);
dalvik_system_ClassExt_ = GcRoot<Class>(dalvik_system_ClassExt);
diff --git a/runtime/mirror/class_ext.h b/runtime/mirror/class_ext.h
index 9104631..ad8a61b 100644
--- a/runtime/mirror/class_ext.h
+++ b/runtime/mirror/class_ext.h
@@ -61,6 +61,12 @@
return GetFieldObject<PointerArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_));
}
+ ByteArray* GetOriginalDexFileBytes() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<ByteArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_));
+ }
+
+ void SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) REQUIRES_SHARED(Locks::mutator_lock_);
+
void SetObsoleteArrays(ObjPtr<PointerArray> methods, ObjPtr<ObjectArray<DexCache>> dex_caches)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -80,7 +86,7 @@
HeapReference<PointerArray> obsolete_methods_;
- HeapReference<DexCache> original_dex_cache_;
+ HeapReference<ByteArray> original_dex_file_bytes_;
// The saved verification error of this class.
HeapReference<Object> verify_error_;
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index acdd0d3..a731c17 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -21,6 +21,7 @@
"object_tagging.cc",
"OpenjdkJvmTi.cc",
"ti_class.cc",
+ "ti_class_definition.cc",
"ti_field.cc",
"ti_heap.cc",
"ti_jni.cc",
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 1c84d4d..256c3a6 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -36,6 +36,7 @@
#include <jni.h>
+#include "base/array_slice.h"
#include "base/casts.h"
#include "base/logging.h"
#include "base/macros.h"
@@ -125,29 +126,6 @@
return ret;
}
-struct ArtClassDefinition {
- jclass klass;
- jobject loader;
- std::string name;
- jobject protection_domain;
- jint dex_len;
- JvmtiUniquePtr dex_data;
- bool modified;
-
- ArtClassDefinition() = default;
- ArtClassDefinition(ArtClassDefinition&& o) = default;
-
- void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
- if (new_dex_data == nullptr) {
- return;
- } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
- modified = true;
- dex_len = new_dex_len;
- dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
- }
- }
-};
-
const jvmtiCapabilities kPotentialCapabilities = {
.can_tag_objects = 1,
.can_generate_field_modification_events = 0,
diff --git a/runtime/openjdkjvmti/ti_class_definition.cc b/runtime/openjdkjvmti/ti_class_definition.cc
new file mode 100644
index 0000000..2c2a79b
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.cc
@@ -0,0 +1,55 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_class_definition.h"
+
+#include "dex_file.h"
+#include "handle_scope-inl.h"
+#include "handle.h"
+#include "mirror/class-inl.h"
+#include "mirror/object-inl.h"
+#include "thread.h"
+
+namespace openjdkjvmti {
+
+bool ArtClassDefinition::IsModified(art::Thread* self) const {
+ if (modified) {
+ return true;
+ }
+ // Check if the dex file we want to set is the same as the current one.
+ art::StackHandleScope<1> hs(self);
+ art::Handle<art::mirror::Class> h_klass(hs.NewHandle(self->DecodeJObject(klass)->AsClass()));
+ const art::DexFile& cur_dex_file = h_klass->GetDexFile();
+ return static_cast<jint>(cur_dex_file.Size()) != dex_len ||
+ memcmp(cur_dex_file.Begin(), dex_data.get(), dex_len) != 0;
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class_definition.h b/runtime/openjdkjvmti/ti_class_definition.h
new file mode 100644
index 0000000..dbe5da2
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.h
@@ -0,0 +1,77 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+
+#include "art_jvmti.h"
+
+namespace openjdkjvmti {
+
+// A struct that stores data needed for redefining/transforming classes. This structure should only
+// even be accessed from a single thread and must not survive past the completion of the
+// redefinition/retransformation function that created it.
+struct ArtClassDefinition {
+ public:
+ jclass klass;
+ jobject loader;
+ std::string name;
+ jobject protection_domain;
+ jint dex_len;
+ JvmtiUniquePtr dex_data;
+ art::ArraySlice<const unsigned char> original_dex_file;
+
+ ArtClassDefinition() = default;
+ ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+ void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+ if (new_dex_data == nullptr) {
+ return;
+ } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+ SetModified();
+ dex_len = new_dex_len;
+ dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+ }
+ }
+
+ void SetModified() {
+ modified = true;
+ }
+
+ bool IsModified(art::Thread* self) const REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ private:
+ bool modified;
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 2db8a40..34efc50 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -36,6 +36,7 @@
#include "android-base/stringprintf.h"
#include "art_jvmti.h"
+#include "base/array_slice.h"
#include "base/logging.h"
#include "dex_file.h"
#include "dex_file_types.h"
@@ -228,11 +229,17 @@
return map;
}
-Redefiner::ClassRedefinition::ClassRedefinition(Redefiner* driver,
- jclass klass,
- const art::DexFile* redefined_dex_file,
- const char* class_sig) :
- driver_(driver), klass_(klass), dex_file_(redefined_dex_file), class_sig_(class_sig) {
+Redefiner::ClassRedefinition::ClassRedefinition(
+ Redefiner* driver,
+ jclass klass,
+ const art::DexFile* redefined_dex_file,
+ const char* class_sig,
+ art::ArraySlice<const unsigned char> orig_dex_file) :
+ driver_(driver),
+ klass_(klass),
+ dex_file_(redefined_dex_file),
+ class_sig_(class_sig),
+ original_dex_file_(orig_dex_file) {
GetMirrorClass()->MonitorEnter(driver_->self_);
}
@@ -280,7 +287,9 @@
def.dex_len = definitions[i].class_byte_count;
def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy);
// We are definitely modified.
- def.modified = true;
+ def.SetModified();
+ def.original_dex_file = art::ArraySlice<const unsigned char>(definitions[i].class_bytes,
+ definitions[i].class_byte_count);
res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
if (res != OK) {
return res;
@@ -313,12 +322,10 @@
art::jit::ScopedJitSuspend suspend_jit;
// Get shared mutator lock so we can lock all the classes.
art::ScopedObjectAccess soa(self);
- std::vector<Redefiner::ClassRedefinition> redefinitions;
- redefinitions.reserve(definitions.size());
Redefiner r(runtime, self, error_msg);
for (const ArtClassDefinition& def : definitions) {
// Only try to transform classes that have been modified.
- if (def.modified) {
+ if (def.IsModified(self)) {
jvmtiError res = r.AddRedefinition(env, def);
if (res != OK) {
return res;
@@ -371,7 +378,11 @@
return ERR(INVALID_CLASS_FORMAT);
}
redefinitions_.push_back(
- Redefiner::ClassRedefinition(this, def.klass, dex_file.release(), signature_ptr));
+ Redefiner::ClassRedefinition(this,
+ def.klass,
+ dex_file.release(),
+ signature_ptr,
+ def.original_dex_file));
return OK;
}
@@ -509,44 +520,48 @@
result_ = result;
}
-bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
- /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
- /*out*/art::MutableHandle<art::mirror::Object>* java_dex_file_obj,
- /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
- /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache) {
- art::StackHandleScope<4> hs(driver_->self_);
- // This shouldn't allocate
- art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
- if (loader.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
+// Allocates a ByteArray big enough to store the given number of bytes and copies them from the
+// bytes pointer.
+static art::mirror::ByteArray* AllocateAndFillBytes(art::Thread* self,
+ const uint8_t* bytes,
+ int32_t num_bytes)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::StackHandleScope<1> hs(self);
+ art::Handle<art::mirror::ByteArray> arr(hs.NewHandle(
+ art::mirror::ByteArray::Alloc(self, num_bytes)));
+ if (!arr.IsNull()) {
+ // Copy it in. Just skip if it's null
+ memcpy(arr->GetData(), bytes, num_bytes);
}
- art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
- if (dex_file_obj.Get() == nullptr) {
- // TODO Better error msg.
- RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
- return false;
+ return arr.Get();
+}
+
+art::mirror::ByteArray* Redefiner::ClassRedefinition::AllocateOrGetOriginalDexFileBytes() {
+ // If we have been specifically given a new set of bytes use that
+ if (original_dex_file_.size() != 0) {
+ return AllocateAndFillBytes(driver_->self_,
+ &original_dex_file_.At(0),
+ original_dex_file_.size());
}
- art::Handle<art::mirror::LongArray> new_cookie(hs.NewHandle(AllocateDexFileCookie(dex_file_obj)));
- if (new_cookie.Get() == nullptr) {
- driver_->self_->AssertPendingOOMException();
- driver_->self_->ClearException();
- RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
- return false;
+
+ // See if we already have one set.
+ art::ObjPtr<art::mirror::ClassExt> ext(GetMirrorClass()->GetExtData());
+ if (!ext.IsNull()) {
+ art::ObjPtr<art::mirror::ByteArray> old_original_bytes(ext->GetOriginalDexFileBytes());
+ if (!old_original_bytes.IsNull()) {
+ // We do. Use it.
+ return old_original_bytes.Ptr();
+ }
}
- art::Handle<art::mirror::DexCache> dex_cache(hs.NewHandle(CreateNewDexCache(loader)));
- if (dex_cache.Get() == nullptr) {
- driver_->self_->AssertPendingOOMException();
- driver_->self_->ClearException();
- RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
- return false;
+
+ // Copy the current dex_file
+ const art::DexFile& current_dex_file = GetMirrorClass()->GetDexFile();
+ // TODO Handle this or make it so it cannot happen.
+ if (current_dex_file.NumClassDefs() != 1) {
+ LOG(WARNING) << "Current dex file has more than one class in it. Calling RetransformClasses "
+ << "on this class might fail if no transformations are applied to it!";
}
- source_class_loader->Assign(loader.Get());
- java_dex_file_obj->Assign(dex_file_obj.Get());
- new_dex_file_cookie->Assign(new_cookie.Get());
- new_dex_cache->Assign(dex_cache.Get());
- return true;
+ return AllocateAndFillBytes(driver_->self_, current_dex_file.Begin(), current_dex_file.Size());
}
struct CallbackCtx {
@@ -741,9 +756,10 @@
kSlotNewDexFileCookie = 2,
kSlotNewDexCache = 3,
kSlotMirrorClass = 4,
+ kSlotOrigDexFile = 5,
// Must be last one.
- kNumSlots = 5,
+ kNumSlots = 6,
};
// This needs to have a HandleScope passed in that is capable of creating a new Handle without
@@ -784,6 +800,11 @@
return art::down_cast<art::mirror::Class*>(GetSlot(klass_index, kSlotMirrorClass));
}
+ art::mirror::ByteArray* GetOriginalDexFileBytes(jint klass_index)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ return art::down_cast<art::mirror::ByteArray*>(GetSlot(klass_index, kSlotOrigDexFile));
+ }
+
void SetSourceClassLoader(jint klass_index, art::mirror::ClassLoader* loader)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
SetSlot(klass_index, kSlotSourceClassLoader, loader);
@@ -804,6 +825,10 @@
REQUIRES_SHARED(art::Locks::mutator_lock_) {
SetSlot(klass_index, kSlotMirrorClass, klass);
}
+ void SetOriginalDexFileBytes(jint klass_index, art::mirror::ByteArray* bytes)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ SetSlot(klass_index, kSlotOrigDexFile, bytes);
+ }
int32_t Length() REQUIRES_SHARED(art::Locks::mutator_lock_) {
return arr_->GetLength() / kNumSlots;
@@ -829,6 +854,51 @@
DISALLOW_COPY_AND_ASSIGN(RedefinitionDataHolder);
};
+bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
+ int32_t klass_index, /*out*/RedefinitionDataHolder* holder) {
+ art::StackHandleScope<2> hs(driver_->self_);
+ holder->SetMirrorClass(klass_index, GetMirrorClass());
+ // This shouldn't allocate
+ art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
+ holder->SetSourceClassLoader(klass_index, loader.Get());
+ if (loader.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
+ holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
+ if (dex_file_obj.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ holder->SetNewDexFileCookie(klass_index, AllocateDexFileCookie(dex_file_obj));
+ if (holder->GetNewDexFileCookie(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
+ return false;
+ }
+ holder->SetNewDexCache(klass_index, CreateNewDexCache(loader));
+ if (holder->GetNewDexCache(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
+ return false;
+ }
+
+ // We won't always need to set this field.
+ holder->SetOriginalDexFileBytes(klass_index, AllocateOrGetOriginalDexFileBytes());
+ if (holder->GetOriginalDexFileBytes(klass_index) == nullptr) {
+ driver_->self_->AssertPendingOOMException();
+ driver_->self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate array for original dex file");
+ return false;
+ }
+ return true;
+}
+
bool Redefiner::CheckAllRedefinitionAreValid() {
for (Redefiner::ClassRedefinition& redef : redefinitions_) {
if (!redef.CheckRedefinitionIsValid()) {
@@ -849,33 +919,11 @@
bool Redefiner::FinishAllRemainingAllocations(RedefinitionDataHolder& holder) {
int32_t cnt = 0;
- art::StackHandleScope<4> hs(self_);
- art::MutableHandle<art::mirror::Object> java_dex_file(hs.NewHandle<art::mirror::Object>(nullptr));
- art::MutableHandle<art::mirror::ClassLoader> source_class_loader(
- hs.NewHandle<art::mirror::ClassLoader>(nullptr));
- art::MutableHandle<art::mirror::LongArray> new_dex_file_cookie(
- hs.NewHandle<art::mirror::LongArray>(nullptr));
- art::MutableHandle<art::mirror::DexCache> new_dex_cache(
- hs.NewHandle<art::mirror::DexCache>(nullptr));
for (Redefiner::ClassRedefinition& redef : redefinitions_) {
- // Reset the out pointers to null
- source_class_loader.Assign(nullptr);
- java_dex_file.Assign(nullptr);
- new_dex_file_cookie.Assign(nullptr);
- new_dex_cache.Assign(nullptr);
// Allocate the data this redefinition requires.
- if (!redef.FinishRemainingAllocations(&source_class_loader,
- &java_dex_file,
- &new_dex_file_cookie,
- &new_dex_cache)) {
+ if (!redef.FinishRemainingAllocations(cnt, &holder)) {
return false;
}
- // Save the allocated data into the holder.
- holder.SetSourceClassLoader(cnt, source_class_loader.Get());
- holder.SetJavaDexFile(cnt, java_dex_file.Get());
- holder.SetNewDexFileCookie(cnt, new_dex_file_cookie.Get());
- holder.SetNewDexCache(cnt, new_dex_cache.Get());
- holder.SetMirrorClass(cnt, redef.GetMirrorClass());
cnt++;
}
return true;
@@ -941,7 +989,7 @@
redef.UpdateJavaDexFile(holder.GetJavaDexFile(cnt), holder.GetNewDexFileCookie(cnt));
// TODO Rewrite so we don't do a stack walk for each and every class.
redef.FindAndAllocateObsoleteMethods(klass);
- redef.UpdateClass(klass, holder.GetNewDexCache(cnt));
+ redef.UpdateClass(klass, holder.GetNewDexCache(cnt), holder.GetOriginalDexFileBytes(cnt));
cnt++;
}
// Ensure that obsolete methods are deoptimized. This is needed since optimized methods may have
@@ -1034,8 +1082,10 @@
}
// Performs updates to class that will allow us to verify it.
-void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
+void Redefiner::ClassRedefinition::UpdateClass(
+ art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ art::ObjPtr<art::mirror::ByteArray> original_dex_file) {
DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
UpdateMethods(mclass, new_dex_cache, class_def);
@@ -1047,6 +1097,9 @@
mclass->SetDexCache(new_dex_cache.Ptr());
mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
+ art::ObjPtr<art::mirror::ClassExt> ext(mclass->GetExtData());
+ CHECK(!ext.IsNull());
+ ext->SetOriginalDexFileBytes(original_dex_file);
}
void Redefiner::ClassRedefinition::UpdateJavaDexFile(
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index f8d51ad..29a7e1f 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -38,6 +38,7 @@
#include "art_jvmti.h"
#include "art_method.h"
+#include "base/array_slice.h"
#include "class_linker.h"
#include "dex_file.h"
#include "gc_root-inl.h"
@@ -56,6 +57,7 @@
#include "obj_ptr.h"
#include "scoped_thread_state_change-inl.h"
#include "stack.h"
+#include "ti_class_definition.h"
#include "thread_list.h"
#include "transform.h"
#include "utf.h"
@@ -100,7 +102,8 @@
ClassRedefinition(Redefiner* driver,
jclass klass,
const art::DexFile* redefined_dex_file,
- const char* class_sig)
+ const char* class_sig,
+ art::ArraySlice<const unsigned char> orig_dex_file)
REQUIRES_SHARED(art::Locks::mutator_lock_);
// NO_THREAD_SAFETY_ANALYSIS so we can unlock the class in the destructor.
@@ -111,7 +114,8 @@
: driver_(other.driver_),
klass_(other.klass_),
dex_file_(std::move(other.dex_file_)),
- class_sig_(std::move(other.class_sig_)) {
+ class_sig_(std::move(other.class_sig_)),
+ original_dex_file_(other.original_dex_file_) {
other.driver_ = nullptr;
}
@@ -130,15 +134,15 @@
art::mirror::LongArray* AllocateDexFileCookie(art::Handle<art::mirror::Object> j_dex_file_obj)
REQUIRES_SHARED(art::Locks::mutator_lock_);
+ // This may return nullptr with a OOME pending if allocation fails.
+ art::mirror::ByteArray* AllocateOrGetOriginalDexFileBytes()
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
void RecordFailure(jvmtiError e, const std::string& err) {
driver_->RecordFailure(e, class_sig_, err);
}
- bool FinishRemainingAllocations(
- /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
- /*out*/art::MutableHandle<art::mirror::Object>* source_dex_file_obj,
- /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
- /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache)
+ bool FinishRemainingAllocations(int32_t klass_index, /*out*/RedefinitionDataHolder* holder)
REQUIRES_SHARED(art::Locks::mutator_lock_);
void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
@@ -191,7 +195,8 @@
REQUIRES(art::Locks::mutator_lock_);
void UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
- art::ObjPtr<art::mirror::DexCache> new_dex_cache)
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ art::ObjPtr<art::mirror::ByteArray> original_dex_file)
REQUIRES(art::Locks::mutator_lock_);
void ReleaseDexFile() REQUIRES_SHARED(art::Locks::mutator_lock_);
@@ -201,6 +206,7 @@
jclass klass_;
std::unique_ptr<const art::DexFile> dex_file_;
std::string class_sig_;
+ art::ArraySlice<const unsigned char> original_dex_file_;
};
jvmtiError result_;
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index 2809cb6..af4fb71 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -47,6 +47,7 @@
#include "mem_map.h"
#include "mirror/array.h"
#include "mirror/class-inl.h"
+#include "mirror/class_ext.h"
#include "mirror/class_loader-inl.h"
#include "mirror/string-inl.h"
#include "oat_file.h"
@@ -138,28 +139,41 @@
return OK;
}
-// TODO Implement this for real once transformed dex data is actually saved.
+static jvmtiError CopyDataIntoJvmtiBuffer(ArtJvmTiEnv* env,
+ const unsigned char* source,
+ jint len,
+ /*out*/unsigned char** dest) {
+ jvmtiError res = env->Allocate(len, dest);
+ if (res != OK) {
+ return res;
+ }
+ memcpy(reinterpret_cast<void*>(*dest),
+ reinterpret_cast<const void*>(source),
+ len);
+ return OK;
+}
+
jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
art::Handle<art::mirror::Class> klass,
/*out*/jint* dex_data_len,
/*out*/unsigned char** dex_data) {
+ art::StackHandleScope<2> hs(art::Thread::Current());
+ art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->GetExtData()));
+ if (!ext.IsNull()) {
+ art::Handle<art::mirror::ByteArray> orig_dex(hs.NewHandle(ext->GetOriginalDexFileBytes()));
+ if (!orig_dex.IsNull()) {
+ *dex_data_len = static_cast<jint>(orig_dex->GetLength());
+ return CopyDataIntoJvmtiBuffer(env,
+ reinterpret_cast<const unsigned char*>(orig_dex->GetData()),
+ *dex_data_len,
+ /*out*/dex_data);
+ }
+ }
// TODO De-quicken the dex file before passing it to the agents.
LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
- LOG(WARNING) << "Caching of initial dex data is not yet performed! Dex data might have been "
- << "transformed by agent already";
const art::DexFile& dex = klass->GetDexFile();
*dex_data_len = static_cast<jint>(dex.Size());
- unsigned char* new_dex_data = nullptr;
- jvmtiError alloc_error = env->Allocate(*dex_data_len, &new_dex_data);
- if (alloc_error != OK) {
- return alloc_error;
- }
- // Copy the data into a temporary buffer.
- memcpy(reinterpret_cast<void*>(new_dex_data),
- reinterpret_cast<const void*>(dex.Begin()),
- *dex_data_len);
- *dex_data = new_dex_data;
- return OK;
+ return CopyDataIntoJvmtiBuffer(env, dex.Begin(), *dex_data_len, /*out*/dex_data);
}
// TODO Move this function somewhere more appropriate.
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ff2bd1..65f2ae1 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -37,6 +37,7 @@
#include <jni.h>
#include "art_jvmti.h"
+#include "ti_class_definition.h"
#include "jvmti.h"
namespace openjdkjvmti {
diff --git a/test/932-transform-saves/build b/test/932-transform-saves/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/932-transform-saves/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/932-transform-saves/expected.txt b/test/932-transform-saves/expected.txt
new file mode 100644
index 0000000..5097771
--- /dev/null
+++ b/test/932-transform-saves/expected.txt
@@ -0,0 +1,3 @@
+hello
+Goodbye
+hello
diff --git a/test/932-transform-saves/info.txt b/test/932-transform-saves/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/932-transform-saves/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/932-transform-saves/run b/test/932-transform-saves/run
new file mode 100755
index 0000000..4379349
--- /dev/null
+++ b/test/932-transform-saves/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --jvmti
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
new file mode 100644
index 0000000..d98ba6d
--- /dev/null
+++ b/test/932-transform-saves/src/Main.java
@@ -0,0 +1,116 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("hello");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+ "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+ "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
+ "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+ "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+ private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+ "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+ "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+ "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+ "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+ "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
+ "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
+
+ public static void doTest(Transform t) {
+ // TODO We currently need to do this transform call since we don't have any way to make the
+ // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+ // manipulation library that is being made when we store the original dex file.
+ // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+ // is one we can return to unaltered.
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+ t.sayHi();
+
+ // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+ addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
+ enableCommonRetransformation(true);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+
+ // Now turn it back to normal by removing the load-hook and transforming again.
+ enableCommonRetransformation(false);
+ doCommonClassRetransformation(Transform.class);
+ t.sayHi();
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+ private static native void doCommonClassRetransformation(Class<?>... target);
+ private static native void enableCommonRetransformation(boolean enable);
+ private static native void addCommonTransformationResult(String target_name,
+ byte[] class_bytes,
+ byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/932-transform-saves/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+ public void sayHi() {
+ // Use lower 'h' to make sure the string will have a different string id
+ // than the transformation (the transformation code is the same except
+ // the actual printed String, which was making the test inacurately passing
+ // in JIT mode when loading the string from the dex cache, as the string ids
+ // of the two different strings were the same).
+ // We know the string ids will be different because lexicographically:
+ // "Goodbye" < "LTransform;" < "hello".
+ System.out.println("hello");
+ }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index c8e2185..639996e 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -311,6 +311,7 @@
929-search \
930-hello-retransform \
931-agent-thread \
+ 932-transform-saves \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 8799c91..4bceef5 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -253,11 +253,12 @@
jint* new_class_data_len,
unsigned char** new_class_data) {
std::string name_str(name);
- if (gTransformations.find(name_str) != gTransformations.end()) {
+ if (gTransformations.find(name_str) != gTransformations.end() &&
+ gTransformations[name_str].size() > 0) {
CommonTransformationResult& res = gTransformations[name_str][0];
const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
unsigned char* new_data;
- jvmti_env->Allocate(desired_array.size(), &new_data);
+ CHECK_EQ(JVMTI_ERROR_NONE, jvmti_env->Allocate(desired_array.size(), &new_data));
memcpy(new_data, desired_array.data(), desired_array.size());
*new_class_data = new_data;
*new_class_data_len = desired_array.size();
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 1b11442..f4ce4c3 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -67,6 +67,7 @@
{ "921-hello-failure", common_retransform::OnLoad, nullptr },
{ "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
{ "930-hello-retransform", common_retransform::OnLoad, nullptr },
+ { "932-transform-saves", common_retransform::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {